Incidental Mutation 'R8973:Pde10a'
ID 683280
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 8525372-8986648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 8924239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 6 (Q6K)
Ref Sequence ENSEMBL: ENSMUSP00000123216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115722] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024647
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115722
Predicted Effect probably benign
Transcript: ENSMUST00000115724
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: Q6K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: Q6K

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T G 18: 57,592,067 L123V possibly damaging Het
1810022K09Rik C T 3: 14,607,245 V97I probably benign Het
2410089E03Rik T C 15: 8,203,793 W1201R probably damaging Het
4930404N11Rik T C 10: 81,364,015 D129G unknown Het
Adamts16 A T 13: 70,738,840 I975N probably benign Het
Adcy8 A G 15: 64,699,135 *1250Q probably null Het
Anapc1 A T 2: 128,664,032 I628N probably damaging Het
Ankub1 A T 3: 57,665,511 S263R possibly damaging Het
Aoah A G 13: 20,840,155 I94V probably benign Het
Aox2 A G 1: 58,289,954 D186G probably benign Het
Arap2 A T 5: 62,698,325 C589* probably null Het
Armt1 T C 10: 4,439,550 L69P probably damaging Het
Atxn7l3 T A 11: 102,292,772 Y185F probably benign Het
BC067074 A G 13: 113,319,759 T780A Het
Cacna2d4 A G 6: 119,241,181 D159G probably damaging Het
Camta2 C A 11: 70,670,358 R1184L probably benign Het
Ccr7 G A 11: 99,145,823 T91I probably damaging Het
Cdh9 A G 15: 16,831,045 T323A possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clec2e C A 6: 129,093,411 G216* probably null Het
Col25a1 T C 3: 130,475,626 S176P unknown Het
Col4a3 A C 1: 82,715,331 I1446L probably benign Het
Cse1l A G 2: 166,943,080 E823G probably damaging Het
Dchs2 A G 3: 83,354,456 E2677G possibly damaging Het
Dis3l T C 9: 64,339,542 E77G probably damaging Het
Dnah6 T C 6: 73,144,751 D1416G probably benign Het
Dpyd T C 3: 119,314,933 probably null Het
Dst A G 1: 34,228,855 D3112G probably damaging Het
Dusp13 A C 14: 21,734,906 N128K probably benign Het
Emilin2 T G 17: 71,275,084 K216Q probably benign Het
Enam T C 5: 88,494,088 W254R possibly damaging Het
Esrrg A C 1: 188,198,750 N346T possibly damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw25 A G 9: 109,650,064 L373P Het
Gm21060 C A 19: 61,296,928 V48L possibly damaging Het
Gm30302 A T 13: 49,788,239 D80E probably benign Het
Gtpbp3 T C 8: 71,491,162 V254A possibly damaging Het
H2-DMb2 A G 17: 34,148,725 D171G probably damaging Het
Hrg A T 16: 22,959,218 T242S probably benign Het
Inf2 G T 12: 112,607,515 C751F unknown Het
Krt13 A T 11: 100,119,438 M239K possibly damaging Het
Lrrc72 A G 12: 36,253,294 S7P probably benign Het
Matn2 A G 15: 34,433,050 I867V probably benign Het
Mdh2 C T 5: 135,790,165 A325V possibly damaging Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrpl16 A T 19: 11,772,943 R64* probably null Het
Nav1 T C 1: 135,584,725 D199G probably benign Het
Nbn T C 4: 15,986,585 V662A probably damaging Het
Nek10 G A 14: 14,931,321 probably null Het
Olfr141 C A 2: 86,806,856 V48F probably benign Het
Olfr298 A G 7: 86,489,279 S91P probably damaging Het
Olfr834 C A 9: 18,988,678 S230* probably null Het
Olfr884 T A 9: 38,047,543 V107D possibly damaging Het
Pcsk7 T G 9: 45,927,642 S617R probably benign Het
Pigq A C 17: 25,932,167 M396R probably damaging Het
Pkhd1l1 T A 15: 44,586,437 D3865E probably damaging Het
Prag1 C T 8: 36,099,590 probably benign Het
Rint1 A G 5: 23,811,730 T498A probably benign Het
Rnf213 T A 11: 119,461,930 F3921I Het
Rpp14 A G 14: 8,088,768 S95G probably benign Het
Ryk T G 9: 102,861,921 Y78D possibly damaging Het
Sez6 A T 11: 77,974,571 Q678L probably damaging Het
Slc22a21 T C 11: 53,969,576 K141E probably damaging Het
Slc30a5 A T 13: 100,806,694 I609K probably damaging Het
Slc44a4 T C 17: 34,921,562 F244L probably damaging Het
Susd5 T C 9: 114,082,504 Y161H possibly damaging Het
Syne3 A G 12: 104,959,395 probably null Het
Tmc1 A T 19: 20,900,851 N93K probably benign Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Tmem131l A T 3: 83,928,732 V690D probably damaging Het
Trim8 A G 19: 46,515,464 Q485R possibly damaging Het
Vmn2r63 A T 7: 42,928,495 H206Q probably benign Het
Vmn2r77 T A 7: 86,802,942 N443K possibly damaging Het
Zan T A 5: 137,389,316 I4878F unknown Het
Zfand4 A G 6: 116,314,080 D344G probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
brautigam UTSW 17 8964677 missense possibly damaging 0.78
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
Nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
R8722:Pde10a UTSW 17 8944940 missense probably benign 0.01
R8918:Pde10a UTSW 17 8941231 missense possibly damaging 0.65
R9113:Pde10a UTSW 17 8978950 missense probably benign
R9163:Pde10a UTSW 17 8962959 missense possibly damaging 0.89
R9275:Pde10a UTSW 17 8981656 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCGGAAAGTGTATCAGTAACGG -3'
(R):5'- ACAAGTTCCAGTGCCTGAAG -3'

Sequencing Primer
(F):5'- ACGGTCCCTACTGTTGTGACAAAG -3'
(R):5'- TGAAGCAACTTCAAGCCTTCAAAC -3'
Posted On 2021-10-11