Incidental Mutation 'R8973:Tmc1'
ID 683288
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20900851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably benign
Transcript: ENSMUST00000039500
AA Change: N93K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: N93K

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T G 18: 57,592,067 L123V possibly damaging Het
1810022K09Rik C T 3: 14,607,245 V97I probably benign Het
2410089E03Rik T C 15: 8,203,793 W1201R probably damaging Het
4930404N11Rik T C 10: 81,364,015 D129G unknown Het
Adamts16 A T 13: 70,738,840 I975N probably benign Het
Adcy8 A G 15: 64,699,135 *1250Q probably null Het
Anapc1 A T 2: 128,664,032 I628N probably damaging Het
Ankub1 A T 3: 57,665,511 S263R possibly damaging Het
Aoah A G 13: 20,840,155 I94V probably benign Het
Aox2 A G 1: 58,289,954 D186G probably benign Het
Arap2 A T 5: 62,698,325 C589* probably null Het
Armt1 T C 10: 4,439,550 L69P probably damaging Het
Atxn7l3 T A 11: 102,292,772 Y185F probably benign Het
BC067074 A G 13: 113,319,759 T780A Het
Cacna2d4 A G 6: 119,241,181 D159G probably damaging Het
Camta2 C A 11: 70,670,358 R1184L probably benign Het
Ccr7 G A 11: 99,145,823 T91I probably damaging Het
Cdh9 A G 15: 16,831,045 T323A possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clec2e C A 6: 129,093,411 G216* probably null Het
Col25a1 T C 3: 130,475,626 S176P unknown Het
Col4a3 A C 1: 82,715,331 I1446L probably benign Het
Cse1l A G 2: 166,943,080 E823G probably damaging Het
Dchs2 A G 3: 83,354,456 E2677G possibly damaging Het
Dis3l T C 9: 64,339,542 E77G probably damaging Het
Dnah6 T C 6: 73,144,751 D1416G probably benign Het
Dpyd T C 3: 119,314,933 probably null Het
Dst A G 1: 34,228,855 D3112G probably damaging Het
Dusp13 A C 14: 21,734,906 N128K probably benign Het
Emilin2 T G 17: 71,275,084 K216Q probably benign Het
Enam T C 5: 88,494,088 W254R possibly damaging Het
Esrrg A C 1: 188,198,750 N346T possibly damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw25 A G 9: 109,650,064 L373P Het
Gm21060 C A 19: 61,296,928 V48L possibly damaging Het
Gm30302 A T 13: 49,788,239 D80E probably benign Het
Gtpbp3 T C 8: 71,491,162 V254A possibly damaging Het
H2-DMb2 A G 17: 34,148,725 D171G probably damaging Het
Hrg A T 16: 22,959,218 T242S probably benign Het
Inf2 G T 12: 112,607,515 C751F unknown Het
Krt13 A T 11: 100,119,438 M239K possibly damaging Het
Lrrc72 A G 12: 36,253,294 S7P probably benign Het
Matn2 A G 15: 34,433,050 I867V probably benign Het
Mdh2 C T 5: 135,790,165 A325V possibly damaging Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrpl16 A T 19: 11,772,943 R64* probably null Het
Nav1 T C 1: 135,584,725 D199G probably benign Het
Nbn T C 4: 15,986,585 V662A probably damaging Het
Nek10 G A 14: 14,931,321 probably null Het
Olfr141 C A 2: 86,806,856 V48F probably benign Het
Olfr298 A G 7: 86,489,279 S91P probably damaging Het
Olfr834 C A 9: 18,988,678 S230* probably null Het
Olfr884 T A 9: 38,047,543 V107D possibly damaging Het
Pcsk7 T G 9: 45,927,642 S617R probably benign Het
Pde10a C A 17: 8,924,239 Q6K probably benign Het
Pigq A C 17: 25,932,167 M396R probably damaging Het
Pkhd1l1 T A 15: 44,586,437 D3865E probably damaging Het
Prag1 C T 8: 36,099,590 probably benign Het
Rint1 A G 5: 23,811,730 T498A probably benign Het
Rnf213 T A 11: 119,461,930 F3921I Het
Rpp14 A G 14: 8,088,768 S95G probably benign Het
Ryk T G 9: 102,861,921 Y78D possibly damaging Het
Sez6 A T 11: 77,974,571 Q678L probably damaging Het
Slc22a21 T C 11: 53,969,576 K141E probably damaging Het
Slc30a5 A T 13: 100,806,694 I609K probably damaging Het
Slc44a4 T C 17: 34,921,562 F244L probably damaging Het
Susd5 T C 9: 114,082,504 Y161H possibly damaging Het
Syne3 A G 12: 104,959,395 probably null Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Tmem131l A T 3: 83,928,732 V690D probably damaging Het
Trim8 A G 19: 46,515,464 Q485R possibly damaging Het
Vmn2r63 A T 7: 42,928,495 H206Q probably benign Het
Vmn2r77 T A 7: 86,802,942 N443K possibly damaging Het
Zan T A 5: 137,389,316 I4878F unknown Het
Zfand4 A G 6: 116,314,080 D344G probably benign Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATCCCTCTAGCTTGTGCATAC -3'
(R):5'- GCCCGATTGCAAGTGTTGAG -3'

Sequencing Primer
(F):5'- CCTCTAGCTTGTGCATACATGAGG -3'
(R):5'- ACAGGCGTCCTTTTAGG -3'
Posted On 2021-10-11