Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Tmc1'

683288

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20900851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 93 (N93K)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably benign
Transcript: ENSMUST00000039500
AA Change: N93K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: N93K

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAATCCCTCTAGCTTGTGCATAC -3'
(R):5'- GCCCGATTGCAAGTGTTGAG -3'

Sequencing Primer
(F):5'- CCTCTAGCTTGTGCATACATGAGG -3'
(R):5'- ACAGGCGTCCTTTTAGG -3'

Posted On

2021-10-11