Incidental Mutation 'R8974:Sec24d'
ID 683298
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8974 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123305849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 324 (D324N)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: D324N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: D324N

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,924,829 V342A probably damaging Het
Acot4 T C 12: 84,043,741 F404S probably benign Het
Alpk1 T C 3: 127,679,931 T808A probably benign Het
Apba3 T C 10: 81,273,198 V154A Het
Arhgap27 A T 11: 103,333,930 F476I possibly damaging Het
Asah2 A T 19: 32,052,905 D122E probably benign Het
Asb10 T C 5: 24,540,211 I47V probably benign Het
Catsperd A G 17: 56,652,525 T322A possibly damaging Het
Ccdc142 T C 6: 83,101,982 V100A probably benign Het
Cdc5l A T 17: 45,404,695 C664S possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep89 A G 7: 35,398,068 S40G probably damaging Het
Csmd2 A G 4: 128,552,587 K3315R Het
Cyp2d34 T C 15: 82,616,336 E434G probably damaging Het
Degs1 A G 1: 182,279,713 Y30H probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam168a A T 7: 100,835,404 T234S probably benign Het
Fzd3 G T 14: 65,234,991 Q443K possibly damaging Het
Galnt7 A G 8: 57,652,900 S27P Het
Gm20767 T A 13: 120,154,950 D108E probably benign Het
Gm30302 T C 13: 49,786,080 D718G probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Hdac2 A G 10: 36,986,344 Y68C probably damaging Het
Lmbr1l A G 15: 98,912,527 C68R probably damaging Het
Loxhd1 A G 18: 77,431,203 T1902A possibly damaging Het
Lrrc4c T C 2: 97,629,647 M206T probably damaging Het
Lrrc75b T C 10: 75,554,014 T168A probably benign Het
Magi1 A G 6: 93,697,242 F1003L probably damaging Het
Map1s T C 8: 70,914,350 L633P probably damaging Het
Mapk11 G A 15: 89,143,811 T341I probably benign Het
Mycbp2 A T 14: 103,124,421 V4441D probably damaging Het
Nin T C 12: 70,078,158 E130G Het
Nod2 T A 8: 88,663,805 Y247N probably damaging Het
Nudcd3 A T 11: 6,193,163 V169E probably benign Het
Olfr1364 A T 13: 21,574,033 I141N probably damaging Het
Olfr621-ps1 T C 7: 103,629,282 Y226C unknown Het
Olfr764-ps1 A C 10: 129,034,036 C269G probably damaging Het
Pcdh9 A C 14: 93,887,677 N352K probably benign Het
Pfpl G A 19: 12,428,475 G30D probably damaging Het
Pi15 A G 1: 17,621,451 D159G possibly damaging Het
Plxna4 G T 6: 32,239,512 R543S possibly damaging Het
Ppp1r12c C T 7: 4,483,699 E543K probably damaging Het
Prkdc T A 16: 15,799,862 probably benign Het
Proca1 T C 11: 78,205,318 S172P probably damaging Het
Ralgapa1 C A 12: 55,677,006 M1578I probably benign Het
Rnf103 C A 6: 71,509,108 A241E probably damaging Het
Rorb T C 19: 18,977,706 D182G probably benign Het
Ryr3 T C 2: 112,912,279 K485E possibly damaging Het
Serpina3f T A 12: 104,217,383 I168N probably damaging Het
Sidt1 A T 16: 44,281,617 *62R probably null Het
Slc22a27 A C 19: 7,926,386 S129A probably damaging Het
Stab1 A G 14: 31,160,822 V408A probably benign Het
Svil G T 18: 5,099,650 G1729W probably damaging Het
Tbx20 A G 9: 24,769,786 S137P probably damaging Het
Trem2 G A 17: 48,348,571 R52Q probably damaging Het
Trim55 T C 3: 19,645,439 S112P probably damaging Het
Vmn1r172 A T 7: 23,660,415 M242L probably benign Het
Vmn2r91 G A 17: 18,105,374 A85T probably benign Het
Zc3h3 T C 15: 75,785,603 T580A probably benign Het
Zfp451 A G 1: 33,777,454 C472R probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTCCCTGGAGTGTAGATC -3'
(R):5'- TAACTGGATACTTTCCTGGAGTTTG -3'

Sequencing Primer
(F):5'- TAGACCGGATATTCCTCCTG -3'
(R):5'- ACTTTCCTGGAGTTTGGCATAAC -3'
Posted On 2021-10-11