Mutagenetix > Incidental Mutations

Incidental Mutation 'R8974:Csmd2'

683300

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R8974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128552587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 3315 (K3315R)

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

AlphaFold

no structure available at present

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	A	G	17: 12,924,829	V342A	probably damaging	Het
Acot4	T	C	12: 84,043,741	F404S	probably benign	Het
Alpk1	T	C	3: 127,679,931	T808A	probably benign	Het
Apba3	T	C	10: 81,273,198	V154A		Het
Arhgap27	A	T	11: 103,333,930	F476I	possibly damaging	Het
Asah2	A	T	19: 32,052,905	D122E	probably benign	Het
Asb10	T	C	5: 24,540,211	I47V	probably benign	Het
Catsperd	A	G	17: 56,652,525	T322A	possibly damaging	Het
Ccdc142	T	C	6: 83,101,982	V100A	probably benign	Het
Cdc5l	A	T	17: 45,404,695	C664S	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Cep89	A	G	7: 35,398,068	S40G	probably damaging	Het
Cyp2d34	T	C	15: 82,616,336	E434G	probably damaging	Het
Degs1	A	G	1: 182,279,713	Y30H	probably benign	Het
Eps8l1	A	G	7: 4,471,818	D266G	probably damaging	Het
Fam168a	A	T	7: 100,835,404	T234S	probably benign	Het
Fzd3	G	T	14: 65,234,991	Q443K	possibly damaging	Het
Galnt7	A	G	8: 57,652,900	S27P		Het
Gm20767	T	A	13: 120,154,950	D108E	probably benign	Het
Gm30302	T	C	13: 49,786,080	D718G	probably benign	Het
Gpr162	T	C	6: 124,860,913	D258G	probably damaging	Het
Hdac2	A	G	10: 36,986,344	Y68C	probably damaging	Het
Lmbr1l	A	G	15: 98,912,527	C68R	probably damaging	Het
Loxhd1	A	G	18: 77,431,203	T1902A	possibly damaging	Het
Lrrc4c	T	C	2: 97,629,647	M206T	probably damaging	Het
Lrrc75b	T	C	10: 75,554,014	T168A	probably benign	Het
Magi1	A	G	6: 93,697,242	F1003L	probably damaging	Het
Map1s	T	C	8: 70,914,350	L633P	probably damaging	Het
Mapk11	G	A	15: 89,143,811	T341I	probably benign	Het
Mycbp2	A	T	14: 103,124,421	V4441D	probably damaging	Het
Nin	T	C	12: 70,078,158	E130G		Het
Nod2	T	A	8: 88,663,805	Y247N	probably damaging	Het
Nudcd3	A	T	11: 6,193,163	V169E	probably benign	Het
Olfr1364	A	T	13: 21,574,033	I141N	probably damaging	Het
Olfr621-ps1	T	C	7: 103,629,282	Y226C	unknown	Het
Olfr764-ps1	A	C	10: 129,034,036	C269G	probably damaging	Het
Pcdh9	A	C	14: 93,887,677	N352K	probably benign	Het
Pfpl	G	A	19: 12,428,475	G30D	probably damaging	Het
Pi15	A	G	1: 17,621,451	D159G	possibly damaging	Het
Plxna4	G	T	6: 32,239,512	R543S	possibly damaging	Het
Ppp1r12c	C	T	7: 4,483,699	E543K	probably damaging	Het
Prkdc	T	A	16: 15,799,862		probably benign	Het
Proca1	T	C	11: 78,205,318	S172P	probably damaging	Het
Ralgapa1	C	A	12: 55,677,006	M1578I	probably benign	Het
Rnf103	C	A	6: 71,509,108	A241E	probably damaging	Het
Rorb	T	C	19: 18,977,706	D182G	probably benign	Het
Ryr3	T	C	2: 112,912,279	K485E	possibly damaging	Het
Sec24d	G	A	3: 123,305,849	D324N	probably damaging	Het
Serpina3f	T	A	12: 104,217,383	I168N	probably damaging	Het
Sidt1	A	T	16: 44,281,617	*62R	probably null	Het
Slc22a27	A	C	19: 7,926,386	S129A	probably damaging	Het
Stab1	A	G	14: 31,160,822	V408A	probably benign	Het
Svil	G	T	18: 5,099,650	G1729W	probably damaging	Het
Tbx20	A	G	9: 24,769,786	S137P	probably damaging	Het
Trem2	G	A	17: 48,348,571	R52Q	probably damaging	Het
Trim55	T	C	3: 19,645,439	S112P	probably damaging	Het
Vmn1r172	A	T	7: 23,660,415	M242L	probably benign	Het
Vmn2r91	G	A	17: 18,105,374	A85T	probably benign	Het
Zc3h3	T	C	15: 75,785,603	T580A	probably benign	Het
Zfp451	A	G	1: 33,777,454	C472R	probably damaging	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense	not run
R9432:Csmd2	UTSW	4	128277211	missense	not run
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- TTGAGGTTCTCCATCACTGGC -3'
(R):5'- TAACTCCCGCCCTAGAAAGG -3'

Sequencing Primer
(F):5'- AGGTTCTCCATCACTGGCTAAGC -3'
(R):5'- TAGAAAGGGCTGGCTCACC -3'

Posted On

2021-10-11