Incidental Mutation 'R8974:Csmd2'
ID 683300
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R8974 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128552587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 3315 (K3315R)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,924,829 V342A probably damaging Het
Acot4 T C 12: 84,043,741 F404S probably benign Het
Alpk1 T C 3: 127,679,931 T808A probably benign Het
Apba3 T C 10: 81,273,198 V154A Het
Arhgap27 A T 11: 103,333,930 F476I possibly damaging Het
Asah2 A T 19: 32,052,905 D122E probably benign Het
Asb10 T C 5: 24,540,211 I47V probably benign Het
Catsperd A G 17: 56,652,525 T322A possibly damaging Het
Ccdc142 T C 6: 83,101,982 V100A probably benign Het
Cdc5l A T 17: 45,404,695 C664S possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep89 A G 7: 35,398,068 S40G probably damaging Het
Cyp2d34 T C 15: 82,616,336 E434G probably damaging Het
Degs1 A G 1: 182,279,713 Y30H probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam168a A T 7: 100,835,404 T234S probably benign Het
Fzd3 G T 14: 65,234,991 Q443K possibly damaging Het
Galnt7 A G 8: 57,652,900 S27P Het
Gm20767 T A 13: 120,154,950 D108E probably benign Het
Gm30302 T C 13: 49,786,080 D718G probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Hdac2 A G 10: 36,986,344 Y68C probably damaging Het
Lmbr1l A G 15: 98,912,527 C68R probably damaging Het
Loxhd1 A G 18: 77,431,203 T1902A possibly damaging Het
Lrrc4c T C 2: 97,629,647 M206T probably damaging Het
Lrrc75b T C 10: 75,554,014 T168A probably benign Het
Magi1 A G 6: 93,697,242 F1003L probably damaging Het
Map1s T C 8: 70,914,350 L633P probably damaging Het
Mapk11 G A 15: 89,143,811 T341I probably benign Het
Mycbp2 A T 14: 103,124,421 V4441D probably damaging Het
Nin T C 12: 70,078,158 E130G Het
Nod2 T A 8: 88,663,805 Y247N probably damaging Het
Nudcd3 A T 11: 6,193,163 V169E probably benign Het
Olfr1364 A T 13: 21,574,033 I141N probably damaging Het
Olfr621-ps1 T C 7: 103,629,282 Y226C unknown Het
Olfr764-ps1 A C 10: 129,034,036 C269G probably damaging Het
Pcdh9 A C 14: 93,887,677 N352K probably benign Het
Pfpl G A 19: 12,428,475 G30D probably damaging Het
Pi15 A G 1: 17,621,451 D159G possibly damaging Het
Plxna4 G T 6: 32,239,512 R543S possibly damaging Het
Ppp1r12c C T 7: 4,483,699 E543K probably damaging Het
Prkdc T A 16: 15,799,862 probably benign Het
Proca1 T C 11: 78,205,318 S172P probably damaging Het
Ralgapa1 C A 12: 55,677,006 M1578I probably benign Het
Rnf103 C A 6: 71,509,108 A241E probably damaging Het
Rorb T C 19: 18,977,706 D182G probably benign Het
Ryr3 T C 2: 112,912,279 K485E possibly damaging Het
Sec24d G A 3: 123,305,849 D324N probably damaging Het
Serpina3f T A 12: 104,217,383 I168N probably damaging Het
Sidt1 A T 16: 44,281,617 *62R probably null Het
Slc22a27 A C 19: 7,926,386 S129A probably damaging Het
Stab1 A G 14: 31,160,822 V408A probably benign Het
Svil G T 18: 5,099,650 G1729W probably damaging Het
Tbx20 A G 9: 24,769,786 S137P probably damaging Het
Trem2 G A 17: 48,348,571 R52Q probably damaging Het
Trim55 T C 3: 19,645,439 S112P probably damaging Het
Vmn1r172 A T 7: 23,660,415 M242L probably benign Het
Vmn2r91 G A 17: 18,105,374 A85T probably benign Het
Zc3h3 T C 15: 75,785,603 T580A probably benign Het
Zfp451 A G 1: 33,777,454 C472R probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9245:Csmd2 UTSW 4 128306375 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense not run
R9432:Csmd2 UTSW 4 128277211 missense not run
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- TTGAGGTTCTCCATCACTGGC -3'
(R):5'- TAACTCCCGCCCTAGAAAGG -3'

Sequencing Primer
(F):5'- AGGTTCTCCATCACTGGCTAAGC -3'
(R):5'- TAGAAAGGGCTGGCTCACC -3'
Posted On 2021-10-11