Incidental Mutation 'R8974:Pcdh9'
ID 683333
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Name protocadherin 9
Synonyms C630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock # R8974 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 93013410-93890679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 93887677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 352 (N352K)
Ref Sequence ENSEMBL: ENSMUSP00000070935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
AlphaFold F8VPK8
Predicted Effect probably benign
Transcript: ENSMUST00000068992
AA Change: N352K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: N352K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: N229K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: N229K

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193901
AA Change: N352K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: N352K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194056
AA Change: N352K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: N352K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably damaging
Transcript: ENSMUST00000195376
AA Change: N352K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: N352K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195826
AA Change: N352K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: N352K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Meta Mutation Damage Score 0.5967 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,924,829 V342A probably damaging Het
Acot4 T C 12: 84,043,741 F404S probably benign Het
Alpk1 T C 3: 127,679,931 T808A probably benign Het
Apba3 T C 10: 81,273,198 V154A Het
Arhgap27 A T 11: 103,333,930 F476I possibly damaging Het
Asah2 A T 19: 32,052,905 D122E probably benign Het
Asb10 T C 5: 24,540,211 I47V probably benign Het
Catsperd A G 17: 56,652,525 T322A possibly damaging Het
Ccdc142 T C 6: 83,101,982 V100A probably benign Het
Cdc5l A T 17: 45,404,695 C664S possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep89 A G 7: 35,398,068 S40G probably damaging Het
Csmd2 A G 4: 128,552,587 K3315R Het
Cyp2d34 T C 15: 82,616,336 E434G probably damaging Het
Degs1 A G 1: 182,279,713 Y30H probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam168a A T 7: 100,835,404 T234S probably benign Het
Fzd3 G T 14: 65,234,991 Q443K possibly damaging Het
Galnt7 A G 8: 57,652,900 S27P Het
Gm20767 T A 13: 120,154,950 D108E probably benign Het
Gm30302 T C 13: 49,786,080 D718G probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Hdac2 A G 10: 36,986,344 Y68C probably damaging Het
Lmbr1l A G 15: 98,912,527 C68R probably damaging Het
Loxhd1 A G 18: 77,431,203 T1902A possibly damaging Het
Lrrc4c T C 2: 97,629,647 M206T probably damaging Het
Lrrc75b T C 10: 75,554,014 T168A probably benign Het
Magi1 A G 6: 93,697,242 F1003L probably damaging Het
Map1s T C 8: 70,914,350 L633P probably damaging Het
Mapk11 G A 15: 89,143,811 T341I probably benign Het
Mycbp2 A T 14: 103,124,421 V4441D probably damaging Het
Nin T C 12: 70,078,158 E130G Het
Nod2 T A 8: 88,663,805 Y247N probably damaging Het
Nudcd3 A T 11: 6,193,163 V169E probably benign Het
Olfr1364 A T 13: 21,574,033 I141N probably damaging Het
Olfr621-ps1 T C 7: 103,629,282 Y226C unknown Het
Olfr764-ps1 A C 10: 129,034,036 C269G probably damaging Het
Pfpl G A 19: 12,428,475 G30D probably damaging Het
Pi15 A G 1: 17,621,451 D159G possibly damaging Het
Plxna4 G T 6: 32,239,512 R543S possibly damaging Het
Ppp1r12c C T 7: 4,483,699 E543K probably damaging Het
Prkdc T A 16: 15,799,862 probably benign Het
Proca1 T C 11: 78,205,318 S172P probably damaging Het
Ralgapa1 C A 12: 55,677,006 M1578I probably benign Het
Rnf103 C A 6: 71,509,108 A241E probably damaging Het
Rorb T C 19: 18,977,706 D182G probably benign Het
Ryr3 T C 2: 112,912,279 K485E possibly damaging Het
Sec24d G A 3: 123,305,849 D324N probably damaging Het
Serpina3f T A 12: 104,217,383 I168N probably damaging Het
Sidt1 A T 16: 44,281,617 *62R probably null Het
Slc22a27 A C 19: 7,926,386 S129A probably damaging Het
Stab1 A G 14: 31,160,822 V408A probably benign Het
Svil G T 18: 5,099,650 G1729W probably damaging Het
Tbx20 A G 9: 24,769,786 S137P probably damaging Het
Trem2 G A 17: 48,348,571 R52Q probably damaging Het
Trim55 T C 3: 19,645,439 S112P probably damaging Het
Vmn1r172 A T 7: 23,660,415 M242L probably benign Het
Vmn2r91 G A 17: 18,105,374 A85T probably benign Het
Zc3h3 T C 15: 75,785,603 T580A probably benign Het
Zfp451 A G 1: 33,777,454 C472R probably damaging Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7780:Pcdh9 UTSW 14 93886551 missense possibly damaging 0.91
R7870:Pcdh9 UTSW 14 93887257 missense probably damaging 0.97
R7921:Pcdh9 UTSW 14 93015565 missense probably benign
R8052:Pcdh9 UTSW 14 93885786 missense probably benign 0.00
R8252:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
R8671:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
R8672:Pcdh9 UTSW 14 93887093 missense probably benign 0.08
R8724:Pcdh9 UTSW 14 93887147 missense probably benign 0.19
R9044:Pcdh9 UTSW 14 93886811 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CACTGCCTTCAAATGAAATGGG -3'
(R):5'- TGCAGACATAGGCAGTAATGC -3'

Sequencing Primer
(F):5'- TGCCTTCAAATGAAATGGGACCTC -3'
(R):5'- AAATCCGGTATATTTTTGGTGCCCAG -3'
Posted On 2021-10-11