Incidental Mutation 'R8974:Asah2'
ID 683350
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock # R8974 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 31984654-32061469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32052905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 122 (D122E)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect probably benign
Transcript: ENSMUST00000096119
AA Change: D122E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: D122E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,924,829 V342A probably damaging Het
Acot4 T C 12: 84,043,741 F404S probably benign Het
Alpk1 T C 3: 127,679,931 T808A probably benign Het
Apba3 T C 10: 81,273,198 V154A Het
Arhgap27 A T 11: 103,333,930 F476I possibly damaging Het
Asb10 T C 5: 24,540,211 I47V probably benign Het
Catsperd A G 17: 56,652,525 T322A possibly damaging Het
Ccdc142 T C 6: 83,101,982 V100A probably benign Het
Cdc5l A T 17: 45,404,695 C664S possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep89 A G 7: 35,398,068 S40G probably damaging Het
Csmd2 A G 4: 128,552,587 K3315R Het
Cyp2d34 T C 15: 82,616,336 E434G probably damaging Het
Degs1 A G 1: 182,279,713 Y30H probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam168a A T 7: 100,835,404 T234S probably benign Het
Fzd3 G T 14: 65,234,991 Q443K possibly damaging Het
Galnt7 A G 8: 57,652,900 S27P Het
Gm20767 T A 13: 120,154,950 D108E probably benign Het
Gm30302 T C 13: 49,786,080 D718G probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Hdac2 A G 10: 36,986,344 Y68C probably damaging Het
Lmbr1l A G 15: 98,912,527 C68R probably damaging Het
Loxhd1 A G 18: 77,431,203 T1902A possibly damaging Het
Lrrc4c T C 2: 97,629,647 M206T probably damaging Het
Lrrc75b T C 10: 75,554,014 T168A probably benign Het
Magi1 A G 6: 93,697,242 F1003L probably damaging Het
Map1s T C 8: 70,914,350 L633P probably damaging Het
Mapk11 G A 15: 89,143,811 T341I probably benign Het
Mycbp2 A T 14: 103,124,421 V4441D probably damaging Het
Nin T C 12: 70,078,158 E130G Het
Nod2 T A 8: 88,663,805 Y247N probably damaging Het
Nudcd3 A T 11: 6,193,163 V169E probably benign Het
Olfr1364 A T 13: 21,574,033 I141N probably damaging Het
Olfr621-ps1 T C 7: 103,629,282 Y226C unknown Het
Olfr764-ps1 A C 10: 129,034,036 C269G probably damaging Het
Pcdh9 A C 14: 93,887,677 N352K probably benign Het
Pfpl G A 19: 12,428,475 G30D probably damaging Het
Pi15 A G 1: 17,621,451 D159G possibly damaging Het
Plxna4 G T 6: 32,239,512 R543S possibly damaging Het
Ppp1r12c C T 7: 4,483,699 E543K probably damaging Het
Prkdc T A 16: 15,799,862 probably null Het
Proca1 T C 11: 78,205,318 S172P probably damaging Het
Ralgapa1 C A 12: 55,677,006 M1578I probably benign Het
Rnf103 C A 6: 71,509,108 A241E probably damaging Het
Rorb T C 19: 18,977,706 D182G probably benign Het
Ryr3 T C 2: 112,912,279 K485E possibly damaging Het
Sec24d G A 3: 123,305,849 D324N probably damaging Het
Serpina3f T A 12: 104,217,383 I168N probably damaging Het
Sidt1 A T 16: 44,281,617 *62R probably null Het
Slc22a27 A C 19: 7,926,386 S129A probably damaging Het
Stab1 A G 14: 31,160,822 V408A probably benign Het
Svil G T 18: 5,099,650 G1729W probably damaging Het
Tbx20 A G 9: 24,769,786 S137P probably damaging Het
Trem2 G A 17: 48,348,571 R52Q probably damaging Het
Trim55 T C 3: 19,645,439 S112P probably damaging Het
Vmn1r172 A T 7: 23,660,415 M242L probably benign Het
Vmn2r91 G A 17: 18,105,374 A85T probably benign Het
Zc3h3 T C 15: 75,785,603 T580A probably benign Het
Zfp451 A G 1: 33,777,454 C472R probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
R8492:Asah2 UTSW 19 32006259 missense probably benign 0.25
R8682:Asah2 UTSW 19 32052877 missense probably damaging 1.00
R8766:Asah2 UTSW 19 32057880 missense possibly damaging 0.46
R8873:Asah2 UTSW 19 32044888 critical splice donor site probably null
R9088:Asah2 UTSW 19 32052960 missense probably damaging 1.00
R9405:Asah2 UTSW 19 32008645 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACACCTTACTTTGAAGGTAGGAG -3'
(R):5'- AGATTGCCAGTCTGATCAGTAC -3'

Sequencing Primer
(F):5'- CCTTACTTTGAAGGTAGGAGATACTC -3'
(R):5'- CTTTCTCTGTACAAATACCAAAGGC -3'
Posted On 2021-10-11