Incidental Mutation 'R8975:Nvl'
ID 683353
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 068809-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 180958001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 260 (N260K)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: N260K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: N260K

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,980,192 (GRCm39) D47G probably damaging Het
4930550C14Rik A T 9: 53,334,258 (GRCm39) K167M possibly damaging Het
Abhd16b A G 2: 181,135,806 (GRCm39) N236S probably benign Het
Ahnak T G 19: 8,990,101 (GRCm39) V3795G probably damaging Het
Atg2b A T 12: 105,602,725 (GRCm39) M1606K probably damaging Het
Bmt2 A T 6: 13,630,611 (GRCm39) I187K probably damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Cep290 A G 10: 100,349,782 (GRCm39) N610D possibly damaging Het
Ctps1 C T 4: 120,406,743 (GRCm39) D338N probably benign Het
Ctsz A T 2: 174,275,421 (GRCm39) I118N probably benign Het
Depdc1b A G 13: 108,525,094 (GRCm39) E483G probably null Het
Dhh T C 15: 98,795,976 (GRCm39) S60G probably damaging Het
Dpagt1 T C 9: 44,237,446 (GRCm39) probably benign Het
Dpy19l1 T C 9: 24,359,102 (GRCm39) K162R probably damaging Het
Dynap T C 18: 70,375,093 (GRCm39) T41A possibly damaging Het
Dyrk4 T C 6: 126,871,783 (GRCm39) N162D probably benign Het
Efcab3 A G 11: 104,954,415 (GRCm39) K5090E probably benign Het
Eml5 T A 12: 98,776,829 (GRCm39) T1429S probably damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fer1l5 A G 1: 36,456,897 (GRCm39) D1625G probably benign Het
Frmd4b G A 6: 97,283,477 (GRCm39) T484M possibly damaging Het
Hhat T C 1: 192,431,250 (GRCm39) E33G probably damaging Het
Ifngr1 A G 10: 19,485,360 (GRCm39) D453G probably damaging Het
Itpr3 T A 17: 27,335,628 (GRCm39) I2246N possibly damaging Het
Larp4b T G 13: 9,195,537 (GRCm39) I212S probably damaging Het
Lilra5 T C 7: 4,241,636 (GRCm39) V145A probably benign Het
Map1lc3a A G 2: 155,118,926 (GRCm39) K30R possibly damaging Het
Mapk8ip1 A G 2: 92,215,166 (GRCm39) Y652H probably damaging Het
Med23 A G 10: 24,780,334 (GRCm39) E994G probably benign Het
Mep1b A T 18: 21,208,714 (GRCm39) D30V probably benign Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mki67 T C 7: 135,300,129 (GRCm39) D1635G probably benign Het
Msantd5f6 A G 4: 73,320,167 (GRCm39) L204P probably damaging Het
Mup3 A T 4: 62,003,472 (GRCm39) D132E probably benign Het
Myo15b A T 11: 115,781,780 (GRCm39) T2830S unknown Het
Myocd T A 11: 65,069,287 (GRCm39) H979L probably damaging Het
Or2a57 T A 6: 43,213,056 (GRCm39) H171Q probably benign Het
Or2d2b T A 7: 106,705,664 (GRCm39) T135S probably benign Het
Or4d2 T A 11: 87,784,645 (GRCm39) Y35F probably damaging Het
Pdha2 C A 3: 140,917,649 (GRCm39) probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phtf2 A C 5: 20,969,249 (GRCm39) V687G probably damaging Het
Plagl2 C T 2: 153,074,346 (GRCm39) G185D possibly damaging Het
Ppp1r3e A G 14: 55,113,946 (GRCm39) V242A probably benign Het
Proser3 A G 7: 30,239,458 (GRCm39) S549P possibly damaging Het
Prrc2c A G 1: 162,533,630 (GRCm39) V995A unknown Het
Ptpn13 A G 5: 103,649,266 (GRCm39) H223R probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn11a T C 9: 119,587,565 (GRCm39) E1393G probably damaging Het
Sipa1l1 T A 12: 82,479,612 (GRCm39) S1432T possibly damaging Het
Slc10a5 G C 3: 10,399,670 (GRCm39) A330G probably benign Het
Slc2a5 A C 4: 150,224,270 (GRCm39) N293H probably damaging Het
Spmap1 A T 11: 97,663,572 (GRCm39) Y93N probably damaging Het
Spmip4 C T 6: 50,561,391 (GRCm39) R176H probably damaging Het
Sptbn1 T C 11: 30,073,869 (GRCm39) E1400G possibly damaging Het
Stk33 T A 7: 108,935,280 (GRCm39) I171F probably damaging Het
Syne1 G A 10: 5,161,945 (GRCm39) H5450Y probably benign Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tkt T A 14: 30,288,884 (GRCm39) probably benign Het
Tpra1 A T 6: 88,888,726 (GRCm39) M303L probably benign Het
Ubr3 T C 2: 69,752,651 (GRCm39) S303P probably damaging Het
Uqcrc1 T C 9: 108,776,721 (GRCm39) F341S probably damaging Het
Vmn1r223 T C 13: 23,434,248 (GRCm39) S281P possibly damaging Het
Vmn1r32 C A 6: 66,530,189 (GRCm39) A196S probably benign Het
Zfp644 G T 5: 106,785,467 (GRCm39) T360N probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AAGGTTCAGGTTTGCTCACCTC -3'
(R):5'- AGCTGTCAGTAGCAGTGGTG -3'

Sequencing Primer
(F):5'- TACATGATGGCTCACACGTG -3'
(R):5'- AGCTGTCGGTGGCAGTG -3'
Posted On 2021-10-11