Incidental Mutation 'R8975:Uqcrc1'
ID 683390
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Name ubiquinol-cytochrome c reductase core protein 1
Synonyms 1110032G10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108936633-108949623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108947653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 341 (F341S)
Ref Sequence ENSEMBL: ENSMUSP00000026743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000194469] [ENSMUST00000195738]
AlphaFold Q9CZ13
Predicted Effect probably damaging
Transcript: ENSMUST00000026743
AA Change: F341S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: F341S

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192305
Predicted Effect probably benign
Transcript: ENSMUST00000194047
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194469
AA Change: F40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141743
Gene: ENSMUSG00000025651
AA Change: F40S

DomainStartEndE-ValueType
Pfam:Peptidase_M16_C 1 94 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,772,746 Y93N probably damaging Het
1700018F24Rik A G 5: 145,043,382 D47G probably damaging Het
4921507P07Rik C T 6: 50,584,411 R176H probably damaging Het
4930550C14Rik A T 9: 53,422,958 K167M possibly damaging Het
Abhd16b A G 2: 181,494,013 N236S probably benign Het
Ahnak T G 19: 9,012,737 V3795G probably damaging Het
Atg2b A T 12: 105,636,466 M1606K probably damaging Het
Bmt2 A T 6: 13,630,612 I187K probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep290 A G 10: 100,513,920 N610D possibly damaging Het
Ctps C T 4: 120,549,546 D338N probably benign Het
Ctsz A T 2: 174,433,628 I118N probably benign Het
Depdc1b A G 13: 108,388,560 E483G probably null Het
Dhh T C 15: 98,898,095 S60G probably damaging Het
Dpy19l1 T C 9: 24,447,806 K162R probably damaging Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Dyrk4 T C 6: 126,894,820 N162D probably benign Het
Eml5 T A 12: 98,810,570 T1429S probably damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fer1l5 A G 1: 36,417,816 D1625G probably benign Het
Frmd4b G A 6: 97,306,516 T484M possibly damaging Het
Gm11487 A G 4: 73,401,930 L204P probably damaging Het
Gm11639 A G 11: 105,063,589 K5090E probably benign Het
Hhat T C 1: 192,748,942 E33G probably damaging Het
Ifngr1 A G 10: 19,609,612 D453G probably damaging Het
Itpr3 T A 17: 27,116,654 I2246N possibly damaging Het
Larp4b T G 13: 9,145,501 I212S probably damaging Het
Lilra5 T C 7: 4,238,637 V145A probably benign Het
Map1lc3a A G 2: 155,277,006 K30R possibly damaging Het
Mapk8ip1 A G 2: 92,384,821 Y652H probably damaging Het
Med23 A G 10: 24,904,436 E994G probably benign Het
Mep1b A T 18: 21,075,657 D30V probably benign Het
Mki67 T C 7: 135,698,400 D1635G probably benign Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mup3 A T 4: 62,085,235 D132E probably benign Het
Myo15b A T 11: 115,890,954 T2830S unknown Het
Myocd T A 11: 65,178,461 H979L probably damaging Het
Nvl A T 1: 181,130,436 N260K probably benign Het
Olfr463 T A 11: 87,893,819 Y35F probably damaging Het
Olfr47 T A 6: 43,236,122 H171Q probably benign Het
Olfr715b T A 7: 107,106,457 T135S probably benign Het
Pdha2 C A 3: 141,211,888 probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phtf2 A C 5: 20,764,251 V687G probably damaging Het
Plagl2 C T 2: 153,232,426 G185D possibly damaging Het
Ppp1r3e A G 14: 54,876,489 V242A probably benign Het
Proser3 A G 7: 30,540,033 S549P possibly damaging Het
Prrc2c A G 1: 162,706,061 V995A unknown Het
Ptpn13 A G 5: 103,501,400 H223R probably benign Het
Rbm33 TCCACCACCACCACCACCACC TCCACCACCACCACCACC 5: 28,361,993 probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,579,908 probably benign Het
Scn11a T C 9: 119,758,499 E1393G probably damaging Het
Sipa1l1 T A 12: 82,432,838 S1432T possibly damaging Het
Slc10a5 G C 3: 10,334,610 A330G probably benign Het
Slc2a5 A C 4: 150,139,813 N293H probably damaging Het
Sptbn1 T C 11: 30,123,869 E1400G possibly damaging Het
Stk33 T A 7: 109,336,073 I171F probably damaging Het
Syne1 G A 10: 5,211,945 H5450Y probably benign Het
Tpra1 A T 6: 88,911,744 M303L probably benign Het
Ubr3 T C 2: 69,922,307 S303P probably damaging Het
Vmn1r223 T C 13: 23,250,078 S281P possibly damaging Het
Vmn1r32 C A 6: 66,553,205 A196S probably benign Het
Zfp644 G T 5: 106,637,601 T360N probably benign Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108947861 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108947405 missense probably benign
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108947622 missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
R8708:Uqcrc1 UTSW 9 108947040 missense probably damaging 0.97
R8889:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8892:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R9136:Uqcrc1 UTSW 9 108947905 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACTGCACTTACGGTGGTG -3'
(R):5'- AGGCGCATCCTAAAGCAAGTG -3'

Sequencing Primer
(F):5'- CACTTACGGTGGTGGAGTGGTAAG -3'
(R):5'- CATCCTAAAGCAAGTGGGAGG -3'
Posted On 2021-10-11