Incidental Mutation 'R8975:Scn11a'
ID683391
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8975 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119758499 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1393 (E1393G)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: E1393G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: E1393G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: E1393G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,772,746 Y93N probably damaging Het
1700018F24Rik A G 5: 145,043,382 D47G probably damaging Het
4921507P07Rik C T 6: 50,584,411 R176H probably damaging Het
4930550C14Rik A T 9: 53,422,958 K167M possibly damaging Het
Abhd16b A G 2: 181,494,013 N236S probably benign Het
Ahnak T G 19: 9,012,737 V3795G probably damaging Het
Atg2b A T 12: 105,636,466 M1606K probably damaging Het
Bmt2 A T 6: 13,630,612 I187K probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep290 A G 10: 100,513,920 N610D possibly damaging Het
Ctps C T 4: 120,549,546 D338N probably benign Het
Ctsz A T 2: 174,433,628 I118N probably benign Het
Depdc1b A G 13: 108,388,560 E483G probably null Het
Dhh T C 15: 98,898,095 S60G probably damaging Het
Dpy19l1 T C 9: 24,447,806 K162R probably damaging Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Dyrk4 T C 6: 126,894,820 N162D probably benign Het
Eml5 T A 12: 98,810,570 T1429S probably damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fer1l5 A G 1: 36,417,816 D1625G probably benign Het
Frmd4b G A 6: 97,306,516 T484M possibly damaging Het
Gm11487 A G 4: 73,401,930 L204P probably damaging Het
Gm11639 A G 11: 105,063,589 K5090E probably benign Het
Hhat T C 1: 192,748,942 E33G probably damaging Het
Ifngr1 A G 10: 19,609,612 D453G probably damaging Het
Itpr3 T A 17: 27,116,654 I2246N possibly damaging Het
Larp4b T G 13: 9,145,501 I212S probably damaging Het
Lilra5 T C 7: 4,238,637 V145A probably benign Het
Map1lc3a A G 2: 155,277,006 K30R possibly damaging Het
Mapk8ip1 A G 2: 92,384,821 Y652H probably damaging Het
Med23 A G 10: 24,904,436 E994G probably benign Het
Mep1b A T 18: 21,075,657 D30V probably benign Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mki67 T C 7: 135,698,400 D1635G probably benign Het
Mup3 A T 4: 62,085,235 D132E probably benign Het
Myo15b A T 11: 115,890,954 T2830S unknown Het
Myocd T A 11: 65,178,461 H979L probably damaging Het
Nvl A T 1: 181,130,436 N260K probably benign Het
Olfr463 T A 11: 87,893,819 Y35F probably damaging Het
Olfr47 T A 6: 43,236,122 H171Q probably benign Het
Olfr715b T A 7: 107,106,457 T135S probably benign Het
Pdha2 C A 3: 141,211,888 probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phtf2 A C 5: 20,764,251 V687G probably damaging Het
Plagl2 C T 2: 153,232,426 G185D possibly damaging Het
Ppp1r3e A G 14: 54,876,489 V242A probably benign Het
Proser3 A G 7: 30,540,033 S549P possibly damaging Het
Prrc2c A G 1: 162,706,061 V995A unknown Het
Ptpn13 A G 5: 103,501,400 H223R probably benign Het
Rbm33 TCCACCACCACCACCACCACC TCCACCACCACCACCACC 5: 28,361,993 probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,579,908 probably benign Het
Sipa1l1 T A 12: 82,432,838 S1432T possibly damaging Het
Slc10a5 G C 3: 10,334,610 A330G probably benign Het
Slc2a5 A C 4: 150,139,813 N293H probably damaging Het
Sptbn1 T C 11: 30,123,869 E1400G possibly damaging Het
Stk33 T A 7: 109,336,073 I171F probably damaging Het
Syne1 G A 10: 5,211,945 H5450Y probably benign Het
Tpra1 A T 6: 88,911,744 M303L probably benign Het
Ubr3 T C 2: 69,922,307 S303P probably damaging Het
Uqcrc1 T C 9: 108,947,653 F341S probably damaging Het
Vmn1r223 T C 13: 23,250,078 S281P possibly damaging Het
Vmn1r32 C A 6: 66,553,205 A196S probably benign Het
Zfp644 G T 5: 106,637,601 T360N probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
R8819:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8820:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8837:Scn11a UTSW 9 119792344 missense probably damaging 1.00
R8913:Scn11a UTSW 9 119794028 missense probably damaging 1.00
R8915:Scn11a UTSW 9 119774297 nonsense probably null
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGCAGCCCTCCTTAG -3'
(R):5'- CAAGCCTTCGTGTTCGATTTGG -3'

Sequencing Primer
(F):5'- CTTTGGAGAAGCTGGACACACTC -3'
(R):5'- TCGATTTGGTCACAAGCCAG -3'
Posted On2021-10-11