Incidental Mutation 'R8975:Scn11a'
ID 683391
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 068809-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119587565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1393 (E1393G)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: E1393G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: E1393G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: E1393G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,980,192 (GRCm39) D47G probably damaging Het
4930550C14Rik A T 9: 53,334,258 (GRCm39) K167M possibly damaging Het
Abhd16b A G 2: 181,135,806 (GRCm39) N236S probably benign Het
Ahnak T G 19: 8,990,101 (GRCm39) V3795G probably damaging Het
Atg2b A T 12: 105,602,725 (GRCm39) M1606K probably damaging Het
Bmt2 A T 6: 13,630,611 (GRCm39) I187K probably damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Cep290 A G 10: 100,349,782 (GRCm39) N610D possibly damaging Het
Ctps1 C T 4: 120,406,743 (GRCm39) D338N probably benign Het
Ctsz A T 2: 174,275,421 (GRCm39) I118N probably benign Het
Depdc1b A G 13: 108,525,094 (GRCm39) E483G probably null Het
Dhh T C 15: 98,795,976 (GRCm39) S60G probably damaging Het
Dpagt1 T C 9: 44,237,446 (GRCm39) probably benign Het
Dpy19l1 T C 9: 24,359,102 (GRCm39) K162R probably damaging Het
Dynap T C 18: 70,375,093 (GRCm39) T41A possibly damaging Het
Dyrk4 T C 6: 126,871,783 (GRCm39) N162D probably benign Het
Efcab3 A G 11: 104,954,415 (GRCm39) K5090E probably benign Het
Eml5 T A 12: 98,776,829 (GRCm39) T1429S probably damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fer1l5 A G 1: 36,456,897 (GRCm39) D1625G probably benign Het
Frmd4b G A 6: 97,283,477 (GRCm39) T484M possibly damaging Het
Hhat T C 1: 192,431,250 (GRCm39) E33G probably damaging Het
Ifngr1 A G 10: 19,485,360 (GRCm39) D453G probably damaging Het
Itpr3 T A 17: 27,335,628 (GRCm39) I2246N possibly damaging Het
Larp4b T G 13: 9,195,537 (GRCm39) I212S probably damaging Het
Lilra5 T C 7: 4,241,636 (GRCm39) V145A probably benign Het
Map1lc3a A G 2: 155,118,926 (GRCm39) K30R possibly damaging Het
Mapk8ip1 A G 2: 92,215,166 (GRCm39) Y652H probably damaging Het
Med23 A G 10: 24,780,334 (GRCm39) E994G probably benign Het
Mep1b A T 18: 21,208,714 (GRCm39) D30V probably benign Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mki67 T C 7: 135,300,129 (GRCm39) D1635G probably benign Het
Msantd5f6 A G 4: 73,320,167 (GRCm39) L204P probably damaging Het
Mup3 A T 4: 62,003,472 (GRCm39) D132E probably benign Het
Myo15b A T 11: 115,781,780 (GRCm39) T2830S unknown Het
Myocd T A 11: 65,069,287 (GRCm39) H979L probably damaging Het
Nvl A T 1: 180,958,001 (GRCm39) N260K probably benign Het
Or2a57 T A 6: 43,213,056 (GRCm39) H171Q probably benign Het
Or2d2b T A 7: 106,705,664 (GRCm39) T135S probably benign Het
Or4d2 T A 11: 87,784,645 (GRCm39) Y35F probably damaging Het
Pdha2 C A 3: 140,917,649 (GRCm39) probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phtf2 A C 5: 20,969,249 (GRCm39) V687G probably damaging Het
Plagl2 C T 2: 153,074,346 (GRCm39) G185D possibly damaging Het
Ppp1r3e A G 14: 55,113,946 (GRCm39) V242A probably benign Het
Proser3 A G 7: 30,239,458 (GRCm39) S549P possibly damaging Het
Prrc2c A G 1: 162,533,630 (GRCm39) V995A unknown Het
Ptpn13 A G 5: 103,649,266 (GRCm39) H223R probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,479,612 (GRCm39) S1432T possibly damaging Het
Slc10a5 G C 3: 10,399,670 (GRCm39) A330G probably benign Het
Slc2a5 A C 4: 150,224,270 (GRCm39) N293H probably damaging Het
Spmap1 A T 11: 97,663,572 (GRCm39) Y93N probably damaging Het
Spmip4 C T 6: 50,561,391 (GRCm39) R176H probably damaging Het
Sptbn1 T C 11: 30,073,869 (GRCm39) E1400G possibly damaging Het
Stk33 T A 7: 108,935,280 (GRCm39) I171F probably damaging Het
Syne1 G A 10: 5,161,945 (GRCm39) H5450Y probably benign Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tkt T A 14: 30,288,884 (GRCm39) probably benign Het
Tpra1 A T 6: 88,888,726 (GRCm39) M303L probably benign Het
Ubr3 T C 2: 69,752,651 (GRCm39) S303P probably damaging Het
Uqcrc1 T C 9: 108,776,721 (GRCm39) F341S probably damaging Het
Vmn1r223 T C 13: 23,434,248 (GRCm39) S281P possibly damaging Het
Vmn1r32 C A 6: 66,530,189 (GRCm39) A196S probably benign Het
Zfp644 G T 5: 106,785,467 (GRCm39) T360N probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACAGAGCAGCCCTCCTTAG -3'
(R):5'- CAAGCCTTCGTGTTCGATTTGG -3'

Sequencing Primer
(F):5'- CTTTGGAGAAGCTGGACACACTC -3'
(R):5'- TCGATTTGGTCACAAGCCAG -3'
Posted On 2021-10-11