Mutagenetix > Incidental Mutation

Incidental Mutation 'R8975:Med23'

683394

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8975 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24904436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 994 (E994G)

Ref Sequence

ENSEMBL: ENSMUSP00000090316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020159
AA Change: E988G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: E988G

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092646
AA Change: E994G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: E994G

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176285
AA Change: E628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: E628G

Domain	Start	End	E-Value	Type
Pfam:Med23	1	51	4.4e-14	PFAM
Pfam:Med23	48	950	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	T	11: 97,772,746	Y93N	probably damaging	Het
1700018F24Rik	A	G	5: 145,043,382	D47G	probably damaging	Het
4921507P07Rik	C	T	6: 50,584,411	R176H	probably damaging	Het
4930550C14Rik	A	T	9: 53,422,958	K167M	possibly damaging	Het
Abhd16b	A	G	2: 181,494,013	N236S	probably benign	Het
Ahnak	T	G	19: 9,012,737	V3795G	probably damaging	Het
Atg2b	A	T	12: 105,636,466	M1606K	probably damaging	Het
Bmt2	A	T	6: 13,630,612	I187K	probably damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Cep290	A	G	10: 100,513,920	N610D	possibly damaging	Het
Ctps	C	T	4: 120,549,546	D338N	probably benign	Het
Ctsz	A	T	2: 174,433,628	I118N	probably benign	Het
Depdc1b	A	G	13: 108,388,560	E483G	probably null	Het
Dhh	T	C	15: 98,898,095	S60G	probably damaging	Het
Dpagt1	T	C	9: 44,326,149		probably benign	Het
Dpy19l1	T	C	9: 24,447,806	K162R	probably damaging	Het
Dynap	T	C	18: 70,242,022	T41A	possibly damaging	Het
Dyrk4	T	C	6: 126,894,820	N162D	probably benign	Het
Eml5	T	A	12: 98,810,570	T1429S	probably damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fer1l5	A	G	1: 36,417,816	D1625G	probably benign	Het
Frmd4b	G	A	6: 97,306,516	T484M	possibly damaging	Het
Gm11487	A	G	4: 73,401,930	L204P	probably damaging	Het
Gm11639	A	G	11: 105,063,589	K5090E	probably benign	Het
Hhat	T	C	1: 192,748,942	E33G	probably damaging	Het
Ifngr1	A	G	10: 19,609,612	D453G	probably damaging	Het
Itpr3	T	A	17: 27,116,654	I2246N	possibly damaging	Het
Larp4b	T	G	13: 9,145,501	I212S	probably damaging	Het
Lilra5	T	C	7: 4,238,637	V145A	probably benign	Het
Map1lc3a	A	G	2: 155,277,006	K30R	possibly damaging	Het
Mapk8ip1	A	G	2: 92,384,821	Y652H	probably damaging	Het
Mep1b	A	T	18: 21,075,657	D30V	probably benign	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mki67	T	C	7: 135,698,400	D1635G	probably benign	Het
Mup3	A	T	4: 62,085,235	D132E	probably benign	Het
Myo15b	A	T	11: 115,890,954	T2830S	unknown	Het
Myocd	T	A	11: 65,178,461	H979L	probably damaging	Het
Nvl	A	T	1: 181,130,436	N260K	probably benign	Het
Olfr463	T	A	11: 87,893,819	Y35F	probably damaging	Het
Olfr47	T	A	6: 43,236,122	H171Q	probably benign	Het
Olfr715b	T	A	7: 107,106,457	T135S	probably benign	Het
Pdha2	C	A	3: 141,211,888		probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Phtf2	A	C	5: 20,764,251	V687G	probably damaging	Het
Plagl2	C	T	2: 153,232,426	G185D	possibly damaging	Het
Ppp1r3e	A	G	14: 54,876,489	V242A	probably benign	Het
Proser3	A	G	7: 30,540,033	S549P	possibly damaging	Het
Prrc2c	A	G	1: 162,706,061	V995A	unknown	Het
Ptpn13	A	G	5: 103,501,400	H223R	probably benign	Het
Rsf1	CG	CGTCGGCGGGG	7: 97,579,908		probably benign	Het
Scn11a	T	C	9: 119,758,499	E1393G	probably damaging	Het
Sipa1l1	T	A	12: 82,432,838	S1432T	possibly damaging	Het
Slc10a5	G	C	3: 10,334,610	A330G	probably benign	Het
Slc2a5	A	C	4: 150,139,813	N293H	probably damaging	Het
Sptbn1	T	C	11: 30,123,869	E1400G	possibly damaging	Het
Stk33	T	A	7: 109,336,073	I171F	probably damaging	Het
Syne1	G	A	10: 5,211,945	H5450Y	probably benign	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tkt	T	A	14: 30,566,927		probably benign	Het
Tpra1	A	T	6: 88,911,744	M303L	probably benign	Het
Ubr3	T	C	2: 69,922,307	S303P	probably damaging	Het
Uqcrc1	T	C	9: 108,947,653	F341S	probably damaging	Het
Vmn1r223	T	C	13: 23,250,078	S281P	possibly damaging	Het
Vmn1r32	C	A	6: 66,553,205	A196S	probably benign	Het
Zfp644	G	T	5: 106,637,601	T360N	probably benign	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
R9131:Med23	UTSW	10	24904381	missense
R9202:Med23	UTSW	10	24904304	missense	probably benign	0.12
R9341:Med23	UTSW	10	24912807	missense	probably benign
R9342:Med23	UTSW	10	24874571	missense	probably benign	0.01
R9343:Med23	UTSW	10	24912807	missense	probably benign
R9412:Med23	UTSW	10	24902121	missense	probably damaging	1.00
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGAGCTACTCTAACACATGTC -3'
(R):5'- ATGGCTCTGTGCTGTGCATC -3'

Sequencing Primer
(F):5'- GAGCTACTCTAACACATGTCTGTCTC -3'
(R):5'- GTGCATCTTGTGACACCTGTATGAC -3'

Posted On

2021-10-11