Incidental Mutation 'R8975:Med23'
ID 683394
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission 068809-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24780334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 994 (E994G)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: E988G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: E988G

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: E994G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: E994G

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: E628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: E628G

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,980,192 (GRCm39) D47G probably damaging Het
4930550C14Rik A T 9: 53,334,258 (GRCm39) K167M possibly damaging Het
Abhd16b A G 2: 181,135,806 (GRCm39) N236S probably benign Het
Ahnak T G 19: 8,990,101 (GRCm39) V3795G probably damaging Het
Atg2b A T 12: 105,602,725 (GRCm39) M1606K probably damaging Het
Bmt2 A T 6: 13,630,611 (GRCm39) I187K probably damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Cep290 A G 10: 100,349,782 (GRCm39) N610D possibly damaging Het
Ctps1 C T 4: 120,406,743 (GRCm39) D338N probably benign Het
Ctsz A T 2: 174,275,421 (GRCm39) I118N probably benign Het
Depdc1b A G 13: 108,525,094 (GRCm39) E483G probably null Het
Dhh T C 15: 98,795,976 (GRCm39) S60G probably damaging Het
Dpagt1 T C 9: 44,237,446 (GRCm39) probably benign Het
Dpy19l1 T C 9: 24,359,102 (GRCm39) K162R probably damaging Het
Dynap T C 18: 70,375,093 (GRCm39) T41A possibly damaging Het
Dyrk4 T C 6: 126,871,783 (GRCm39) N162D probably benign Het
Efcab3 A G 11: 104,954,415 (GRCm39) K5090E probably benign Het
Eml5 T A 12: 98,776,829 (GRCm39) T1429S probably damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fer1l5 A G 1: 36,456,897 (GRCm39) D1625G probably benign Het
Frmd4b G A 6: 97,283,477 (GRCm39) T484M possibly damaging Het
Hhat T C 1: 192,431,250 (GRCm39) E33G probably damaging Het
Ifngr1 A G 10: 19,485,360 (GRCm39) D453G probably damaging Het
Itpr3 T A 17: 27,335,628 (GRCm39) I2246N possibly damaging Het
Larp4b T G 13: 9,195,537 (GRCm39) I212S probably damaging Het
Lilra5 T C 7: 4,241,636 (GRCm39) V145A probably benign Het
Map1lc3a A G 2: 155,118,926 (GRCm39) K30R possibly damaging Het
Mapk8ip1 A G 2: 92,215,166 (GRCm39) Y652H probably damaging Het
Mep1b A T 18: 21,208,714 (GRCm39) D30V probably benign Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mki67 T C 7: 135,300,129 (GRCm39) D1635G probably benign Het
Msantd5f6 A G 4: 73,320,167 (GRCm39) L204P probably damaging Het
Mup3 A T 4: 62,003,472 (GRCm39) D132E probably benign Het
Myo15b A T 11: 115,781,780 (GRCm39) T2830S unknown Het
Myocd T A 11: 65,069,287 (GRCm39) H979L probably damaging Het
Nvl A T 1: 180,958,001 (GRCm39) N260K probably benign Het
Or2a57 T A 6: 43,213,056 (GRCm39) H171Q probably benign Het
Or2d2b T A 7: 106,705,664 (GRCm39) T135S probably benign Het
Or4d2 T A 11: 87,784,645 (GRCm39) Y35F probably damaging Het
Pdha2 C A 3: 140,917,649 (GRCm39) probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phtf2 A C 5: 20,969,249 (GRCm39) V687G probably damaging Het
Plagl2 C T 2: 153,074,346 (GRCm39) G185D possibly damaging Het
Ppp1r3e A G 14: 55,113,946 (GRCm39) V242A probably benign Het
Proser3 A G 7: 30,239,458 (GRCm39) S549P possibly damaging Het
Prrc2c A G 1: 162,533,630 (GRCm39) V995A unknown Het
Ptpn13 A G 5: 103,649,266 (GRCm39) H223R probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn11a T C 9: 119,587,565 (GRCm39) E1393G probably damaging Het
Sipa1l1 T A 12: 82,479,612 (GRCm39) S1432T possibly damaging Het
Slc10a5 G C 3: 10,399,670 (GRCm39) A330G probably benign Het
Slc2a5 A C 4: 150,224,270 (GRCm39) N293H probably damaging Het
Spmap1 A T 11: 97,663,572 (GRCm39) Y93N probably damaging Het
Spmip4 C T 6: 50,561,391 (GRCm39) R176H probably damaging Het
Sptbn1 T C 11: 30,073,869 (GRCm39) E1400G possibly damaging Het
Stk33 T A 7: 108,935,280 (GRCm39) I171F probably damaging Het
Syne1 G A 10: 5,161,945 (GRCm39) H5450Y probably benign Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tkt T A 14: 30,288,884 (GRCm39) probably benign Het
Tpra1 A T 6: 88,888,726 (GRCm39) M303L probably benign Het
Ubr3 T C 2: 69,752,651 (GRCm39) S303P probably damaging Het
Uqcrc1 T C 9: 108,776,721 (GRCm39) F341S probably damaging Het
Vmn1r223 T C 13: 23,434,248 (GRCm39) S281P possibly damaging Het
Vmn1r32 C A 6: 66,530,189 (GRCm39) A196S probably benign Het
Zfp644 G T 5: 106,785,467 (GRCm39) T360N probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAGCTACTCTAACACATGTC -3'
(R):5'- ATGGCTCTGTGCTGTGCATC -3'

Sequencing Primer
(F):5'- GAGCTACTCTAACACATGTCTGTCTC -3'
(R):5'- GTGCATCTTGTGACACCTGTATGAC -3'
Posted On 2021-10-11