Incidental Mutation 'R8975:Cep290'
ID 683395
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 068809-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100349782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 610 (N610D)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect possibly damaging
Transcript: ENSMUST00000164751
AA Change: N610D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: N610D

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: N603D

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220346
AA Change: N610D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,980,192 (GRCm39) D47G probably damaging Het
4930550C14Rik A T 9: 53,334,258 (GRCm39) K167M possibly damaging Het
Abhd16b A G 2: 181,135,806 (GRCm39) N236S probably benign Het
Ahnak T G 19: 8,990,101 (GRCm39) V3795G probably damaging Het
Atg2b A T 12: 105,602,725 (GRCm39) M1606K probably damaging Het
Bmt2 A T 6: 13,630,611 (GRCm39) I187K probably damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Ctps1 C T 4: 120,406,743 (GRCm39) D338N probably benign Het
Ctsz A T 2: 174,275,421 (GRCm39) I118N probably benign Het
Depdc1b A G 13: 108,525,094 (GRCm39) E483G probably null Het
Dhh T C 15: 98,795,976 (GRCm39) S60G probably damaging Het
Dpagt1 T C 9: 44,237,446 (GRCm39) probably benign Het
Dpy19l1 T C 9: 24,359,102 (GRCm39) K162R probably damaging Het
Dynap T C 18: 70,375,093 (GRCm39) T41A possibly damaging Het
Dyrk4 T C 6: 126,871,783 (GRCm39) N162D probably benign Het
Efcab3 A G 11: 104,954,415 (GRCm39) K5090E probably benign Het
Eml5 T A 12: 98,776,829 (GRCm39) T1429S probably damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fer1l5 A G 1: 36,456,897 (GRCm39) D1625G probably benign Het
Frmd4b G A 6: 97,283,477 (GRCm39) T484M possibly damaging Het
Hhat T C 1: 192,431,250 (GRCm39) E33G probably damaging Het
Ifngr1 A G 10: 19,485,360 (GRCm39) D453G probably damaging Het
Itpr3 T A 17: 27,335,628 (GRCm39) I2246N possibly damaging Het
Larp4b T G 13: 9,195,537 (GRCm39) I212S probably damaging Het
Lilra5 T C 7: 4,241,636 (GRCm39) V145A probably benign Het
Map1lc3a A G 2: 155,118,926 (GRCm39) K30R possibly damaging Het
Mapk8ip1 A G 2: 92,215,166 (GRCm39) Y652H probably damaging Het
Med23 A G 10: 24,780,334 (GRCm39) E994G probably benign Het
Mep1b A T 18: 21,208,714 (GRCm39) D30V probably benign Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mki67 T C 7: 135,300,129 (GRCm39) D1635G probably benign Het
Msantd5f6 A G 4: 73,320,167 (GRCm39) L204P probably damaging Het
Mup3 A T 4: 62,003,472 (GRCm39) D132E probably benign Het
Myo15b A T 11: 115,781,780 (GRCm39) T2830S unknown Het
Myocd T A 11: 65,069,287 (GRCm39) H979L probably damaging Het
Nvl A T 1: 180,958,001 (GRCm39) N260K probably benign Het
Or2a57 T A 6: 43,213,056 (GRCm39) H171Q probably benign Het
Or2d2b T A 7: 106,705,664 (GRCm39) T135S probably benign Het
Or4d2 T A 11: 87,784,645 (GRCm39) Y35F probably damaging Het
Pdha2 C A 3: 140,917,649 (GRCm39) probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phtf2 A C 5: 20,969,249 (GRCm39) V687G probably damaging Het
Plagl2 C T 2: 153,074,346 (GRCm39) G185D possibly damaging Het
Ppp1r3e A G 14: 55,113,946 (GRCm39) V242A probably benign Het
Proser3 A G 7: 30,239,458 (GRCm39) S549P possibly damaging Het
Prrc2c A G 1: 162,533,630 (GRCm39) V995A unknown Het
Ptpn13 A G 5: 103,649,266 (GRCm39) H223R probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn11a T C 9: 119,587,565 (GRCm39) E1393G probably damaging Het
Sipa1l1 T A 12: 82,479,612 (GRCm39) S1432T possibly damaging Het
Slc10a5 G C 3: 10,399,670 (GRCm39) A330G probably benign Het
Slc2a5 A C 4: 150,224,270 (GRCm39) N293H probably damaging Het
Spmap1 A T 11: 97,663,572 (GRCm39) Y93N probably damaging Het
Spmip4 C T 6: 50,561,391 (GRCm39) R176H probably damaging Het
Sptbn1 T C 11: 30,073,869 (GRCm39) E1400G possibly damaging Het
Stk33 T A 7: 108,935,280 (GRCm39) I171F probably damaging Het
Syne1 G A 10: 5,161,945 (GRCm39) H5450Y probably benign Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tkt T A 14: 30,288,884 (GRCm39) probably benign Het
Tpra1 A T 6: 88,888,726 (GRCm39) M303L probably benign Het
Ubr3 T C 2: 69,752,651 (GRCm39) S303P probably damaging Het
Uqcrc1 T C 9: 108,776,721 (GRCm39) F341S probably damaging Het
Vmn1r223 T C 13: 23,434,248 (GRCm39) S281P possibly damaging Het
Vmn1r32 C A 6: 66,530,189 (GRCm39) A196S probably benign Het
Zfp644 G T 5: 106,785,467 (GRCm39) T360N probably benign Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGGTAGAATCGTGGCC -3'
(R):5'- CACTTGAGCATAAAATATGTGACAC -3'

Sequencing Primer
(F):5'- GGTAGAATCGTGGCCATCTC -3'
(R):5'- AAACATAGCAATGTAAACTACAAAGC -3'
Posted On 2021-10-11