Incidental Mutation 'R8976:Ptprk'
ID683448
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8976 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28585673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1153 (R1153H)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
AlphaFold P35822
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: R1139H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: R1139H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: R1153H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: R1127H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000220357
AA Change: R68H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 A G 3: 87,728,014 I906V probably benign Het
Atad2b T A 12: 4,917,923 probably null Het
Atr T A 9: 95,890,766 D1243E probably benign Het
Baiap2l1 A T 5: 144,286,307 H73Q probably benign Het
Bdp1 C A 13: 100,060,899 G993* probably null Het
C87414 T A 5: 93,638,118 N101I probably damaging Het
Cacna2d4 A T 6: 119,338,157 I883F possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Crem A G 18: 3,268,088 V80A possibly damaging Het
Cyp2j9 T C 4: 96,591,162 K62E probably benign Het
Dnah17 T A 11: 118,026,840 I4132F probably damaging Het
Dnm3 G A 1: 162,307,936 P423S probably damaging Het
Dopey2 G T 16: 93,762,081 V572L probably benign Het
F2 A G 2: 91,636,393 S2P probably benign Het
Fam171a2 T C 11: 102,438,625 E436G possibly damaging Het
Fat1 T C 8: 45,031,295 V3190A probably benign Het
Flnb A T 14: 7,901,882 probably null Het
Frs3 A T 17: 47,698,621 D9V probably benign Het
Galnt17 T G 5: 130,906,705 E380A probably benign Het
Glrb A C 3: 80,851,056 V350G probably damaging Het
Helz2 T A 2: 181,234,693 K1336M possibly damaging Het
Ifnlr1 T A 4: 135,701,339 V159E probably damaging Het
Igf2r T C 17: 12,726,772 E310G probably damaging Het
Il2rb C T 15: 78,486,481 D145N probably benign Het
Iqcb1 A G 16: 36,871,643 I535V probably benign Het
Keap1 A C 9: 21,231,367 L531V probably damaging Het
Lrrc8d T A 5: 105,813,091 W456R probably damaging Het
Med12l T A 3: 59,275,908 H1910Q probably damaging Het
Mfsd7a A C 5: 108,442,031 S502A probably benign Het
Mybphl G A 3: 108,365,018 E8K probably damaging Het
Olfr1354 T C 10: 78,917,584 I248T possibly damaging Het
Olfr17 T C 7: 107,098,259 S265P possibly damaging Het
Olfr498 T A 7: 108,465,423 I33N possibly damaging Het
Olfr523 T C 7: 140,176,972 V284A probably damaging Het
Olfr837 T A 9: 19,137,845 M284K probably damaging Het
Olig2 A G 16: 91,226,475 S26G probably benign Het
Pcdhb22 G A 18: 37,518,343 probably benign Het
Plekha8 A T 6: 54,630,536 E376V probably damaging Het
Polr2a A G 11: 69,747,211 V144A possibly damaging Het
Prr18 T C 17: 8,341,215 S68P probably damaging Het
Pus1 A G 5: 110,774,923 F293L possibly damaging Het
Shank3 A G 15: 89,558,178 E1758G probably damaging Het
Ska3 A T 14: 57,820,394 I167N probably damaging Het
Ski A G 4: 155,157,954 S663P probably damaging Het
Spa17 C T 9: 37,611,958 R11Q possibly damaging Het
Spag5 T C 11: 78,304,587 V240A probably benign Het
Srl A T 16: 4,483,030 Y726N probably damaging Het
Ssbp4 A T 8: 70,599,686 probably null Het
Tigd3 G A 19: 5,891,825 P426S probably benign Het
Tmem176b A G 6: 48,835,666 S122P probably damaging Het
Trim23 G T 13: 104,192,037 L355F probably damaging Het
Ttn G A 2: 76,714,766 T32664M probably damaging Het
Unc80 A G 1: 66,472,010 H59R possibly damaging Het
Vmn1r19 A G 6: 57,404,734 I91V probably benign Het
Zbtb14 G A 17: 69,387,757 R150H possibly damaging Het
Zfp831 T C 2: 174,645,286 Y585H possibly damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8897:Ptprk UTSW 10 28591957 missense probably damaging 1.00
R8910:Ptprk UTSW 10 28492997 missense possibly damaging 0.68
R8919:Ptprk UTSW 10 28483207 nonsense probably null
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9036:Ptprk UTSW 10 28585932 missense probably benign 0.01
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTTGATGACGTGTGACTC -3'
(R):5'- CAGGCTTCTAAAATGGCATCATG -3'

Sequencing Primer
(F):5'- TGATGACGTGTGACTCAAAATAC -3'
(R):5'- AGGAAAGAGAGACAATTTCATATGAG -3'
Posted On2021-10-11