Incidental Mutation 'R8976:Atad2b'
ID 683454
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8976 (G1)
Quality Score 165.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 4917923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 A G 3: 87,728,014 I906V probably benign Het
Atr T A 9: 95,890,766 D1243E probably benign Het
Baiap2l1 A T 5: 144,286,307 H73Q probably benign Het
Bdp1 C A 13: 100,060,899 G993* probably null Het
C87414 T A 5: 93,638,118 N101I probably damaging Het
Cacna2d4 A T 6: 119,338,157 I883F possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Crem A G 18: 3,268,088 V80A possibly damaging Het
Cyp2j9 T C 4: 96,591,162 K62E probably benign Het
Dnah17 T A 11: 118,026,840 I4132F probably damaging Het
Dnm3 G A 1: 162,307,936 P423S probably damaging Het
Dopey2 G T 16: 93,762,081 V572L probably benign Het
F2 A G 2: 91,636,393 S2P probably benign Het
Fam171a2 T C 11: 102,438,625 E436G possibly damaging Het
Fat1 T C 8: 45,031,295 V3190A probably benign Het
Flnb A T 14: 7,901,882 probably null Het
Frs3 A T 17: 47,698,621 D9V probably benign Het
Galnt17 T G 5: 130,906,705 E380A probably benign Het
Glrb A C 3: 80,851,056 V350G probably damaging Het
Helz2 T A 2: 181,234,693 K1336M possibly damaging Het
Ifnlr1 T A 4: 135,701,339 V159E probably damaging Het
Igf2r T C 17: 12,726,772 E310G probably damaging Het
Il2rb C T 15: 78,486,481 D145N probably benign Het
Iqcb1 A G 16: 36,871,643 I535V probably benign Het
Keap1 A C 9: 21,231,367 L531V probably damaging Het
Lrrc8d T A 5: 105,813,091 W456R probably damaging Het
Med12l T A 3: 59,275,908 H1910Q probably damaging Het
Mfsd7a A C 5: 108,442,031 S502A probably benign Het
Mybphl G A 3: 108,365,018 E8K probably damaging Het
Olfr1354 T C 10: 78,917,584 I248T possibly damaging Het
Olfr17 T C 7: 107,098,259 S265P possibly damaging Het
Olfr498 T A 7: 108,465,423 I33N possibly damaging Het
Olfr523 T C 7: 140,176,972 V284A probably damaging Het
Olfr837 T A 9: 19,137,845 M284K probably damaging Het
Olig2 A G 16: 91,226,475 S26G probably benign Het
Pcdhb22 G A 18: 37,518,343 probably benign Het
Plekha8 A T 6: 54,630,536 E376V probably damaging Het
Polr2a A G 11: 69,747,211 V144A possibly damaging Het
Prr18 T C 17: 8,341,215 S68P probably damaging Het
Ptprk G A 10: 28,585,673 R1153H probably damaging Het
Pus1 A G 5: 110,774,923 F293L possibly damaging Het
Shank3 A G 15: 89,558,178 E1758G probably damaging Het
Ska3 A T 14: 57,820,394 I167N probably damaging Het
Ski A G 4: 155,157,954 S663P probably damaging Het
Spa17 C T 9: 37,611,958 R11Q possibly damaging Het
Spag5 T C 11: 78,304,587 V240A probably benign Het
Srl A T 16: 4,483,030 Y726N probably damaging Het
Ssbp4 A T 8: 70,599,686 probably null Het
Tigd3 G A 19: 5,891,825 P426S probably benign Het
Tmem176b A G 6: 48,835,666 S122P probably damaging Het
Trim23 G T 13: 104,192,037 L355F probably damaging Het
Ttn G A 2: 76,714,766 T32664M probably damaging Het
Unc80 A G 1: 66,472,010 H59R possibly damaging Het
Vmn1r19 A G 6: 57,404,734 I91V probably benign Het
Zbtb14 G A 17: 69,387,757 R150H possibly damaging Het
Zfp831 T C 2: 174,645,286 Y585H possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTGGACCATGGTGAACAC -3'
(R):5'- CGTGGACTCGAGTGCTGTTC -3'

Sequencing Primer
(F):5'- GAACACCCGGAAGAGCTCTCTG -3'
(R):5'- CTCGAGTGCTGTTCTTTACACAAAAG -3'
Posted On 2021-10-11