Incidental Mutation 'R8977:Ggcx'
ID 683491
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Name gamma-glutamyl carboxylase
Synonyms vitamin K-dependent carboxylase
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.836) question?
Stock # R8977 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72414308-72430712 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72429282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205738] [ENSMUST00000205823]
AlphaFold Q9QYC7
Predicted Effect probably benign
Transcript: ENSMUST00000059472
SMART Domains Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

DomainStartEndE-ValueType
Pfam:S-AdoMet_synt_N 17 115 1.7e-45 PFAM
Pfam:S-AdoMet_synt_M 129 250 2.4e-47 PFAM
Pfam:S-AdoMet_synt_C 252 389 1.5e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065906
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205335
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably benign
Transcript: ENSMUST00000205823
Predicted Effect probably benign
Transcript: ENSMUST00000206904
Predicted Effect probably benign
Transcript: ENSMUST00000207000
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,328,408 I984N probably damaging Het
4930438A08Rik A G 11: 58,293,884 E476G unknown Het
Aars G A 8: 111,040,217 R77Q probably damaging Het
Abcc10 C A 17: 46,313,667 V795L probably benign Het
Adam30 A G 3: 98,162,062 K276E probably damaging Het
Adam6b A T 12: 113,490,376 N271I probably benign Het
Adgrl2 T C 3: 148,954,587 I17V probably null Het
Anapc1 C A 2: 128,641,402 G1258C probably damaging Het
Ank2 G T 3: 126,944,926 H2436Q unknown Het
Ankrd13a A T 5: 114,795,745 K267* probably null Het
Apob T C 12: 8,015,990 Y4320H probably damaging Het
Atp2b2 T C 6: 113,773,364 D678G probably damaging Het
Bhlhe41 C A 6: 145,863,370 V239F possibly damaging Het
Cbfa2t2 T G 2: 154,500,490 L42R probably benign Het
Ccdc173 T C 2: 69,787,299 H46R possibly damaging Het
Ccer2 G A 7: 28,756,688 V52M probably damaging Het
Ccnj T C 19: 40,844,939 F187S probably damaging Het
Cd109 G A 9: 78,707,528 V1286I probably benign Het
Cfap46 G T 7: 139,679,933 T148N probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Cuzd1 A G 7: 131,322,025 F8S probably benign Het
Dnmbp A T 19: 43,852,312 D549E probably damaging Het
Dpp4 A G 2: 62,374,403 L240P probably benign Het
Dst A T 1: 34,247,783 R3398S probably damaging Het
Eml6 A G 11: 29,784,182 I1186T possibly damaging Het
Extl1 T C 4: 134,359,124 E540G possibly damaging Het
Gdpd5 A G 7: 99,453,850 I339V probably benign Het
Gm9195 A G 14: 72,453,898 F1637L unknown Het
Igkv5-48 G C 6: 69,726,632 N96K possibly damaging Het
Itga11 T C 9: 62,755,640 I546T probably damaging Het
Map3k5 T A 10: 20,079,254 F624L possibly damaging Het
Map7 T A 10: 20,269,590 probably null Het
Mdga2 A T 12: 66,797,635 D196E possibly damaging Het
Mettl2 T C 11: 105,128,965 C143R probably benign Het
Mut G T 17: 40,938,590 R152L probably benign Het
Ncam1 G T 9: 49,507,525 T825K probably damaging Het
Nucb2 C A 7: 116,528,828 N257K probably benign Het
Olfr1085 C T 2: 86,658,128 C110Y probably benign Het
Olfr1535 T A 13: 21,555,846 M59L possibly damaging Het
Olfr378 A G 11: 73,425,825 S53P probably benign Het
Olfr406 A T 11: 74,269,478 I30F probably benign Het
Olfr640 A T 7: 104,021,555 Y254* probably null Het
Olfr664 A T 7: 104,734,041 F108I probably damaging Het
Pamr1 T A 2: 102,611,618 V184D probably damaging Het
Paqr9 A T 9: 95,560,835 I293F possibly damaging Het
Pi15 G T 1: 17,619,902 probably null Het
Pkm T A 9: 59,671,640 I301N probably damaging Het
Pramel1 T A 4: 143,397,391 I212N probably benign Het
Prdm6 A T 18: 53,568,301 I549F probably damaging Het
Prpf8 A G 11: 75,496,044 E1105G probably benign Het
Rad51b T A 12: 79,657,888 V274E probably damaging Het
Rd3l T A 12: 111,980,159 Y61F probably damaging Het
Rgs11 T C 17: 26,208,259 V388A probably damaging Het
Rictor A G 15: 6,783,085 I901V probably benign Het
Riox2 A G 16: 59,491,832 D444G probably benign Het
Scn2a T A 2: 65,763,670 V1621E probably damaging Het
Sec11c A G 18: 65,812,747 I94V possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc34a1 T C 13: 55,409,002 I337T probably benign Het
Slc6a19 T C 13: 73,682,150 K516E probably benign Het
Slco1b2 A T 6: 141,683,254 M596L probably benign Het
Smarce1 A G 11: 99,219,685 I100T possibly damaging Het
Stk32c A T 7: 139,125,245 M119K possibly damaging Het
Tekt2 T C 4: 126,323,473 probably null Het
Tenm4 A T 7: 96,811,970 N908Y probably damaging Het
Tex38 A G 4: 115,780,595 S4P probably benign Het
Top2b T A 14: 16,393,239 H299Q probably benign Het
Trim55 C A 3: 19,659,177 R131S probably benign Het
Vmn2r109 A T 17: 20,554,269 Y275N possibly damaging Het
Vmn2r116 C T 17: 23,386,942 T276I possibly damaging Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72429958 splice site probably null
IGL02373:Ggcx APN 6 72427919 missense probably damaging 1.00
IGL02589:Ggcx APN 6 72429148 missense probably damaging 1.00
IGL02634:Ggcx APN 6 72418303 missense probably damaging 1.00
IGL02661:Ggcx APN 6 72418360 missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72418472 intron probably benign
R0503:Ggcx UTSW 6 72429157 frame shift probably null
R1034:Ggcx UTSW 6 72414831 missense probably damaging 1.00
R2219:Ggcx UTSW 6 72427982 missense probably benign 0.29
R3892:Ggcx UTSW 6 72418372 missense probably damaging 0.99
R3951:Ggcx UTSW 6 72426558 missense probably benign 0.01
R3952:Ggcx UTSW 6 72426558 missense probably benign 0.01
R4320:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4321:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4322:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4324:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4782:Ggcx UTSW 6 72428892 missense probably benign 0.01
R5370:Ggcx UTSW 6 72425931 missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72424034 missense probably damaging 1.00
R5902:Ggcx UTSW 6 72429996 missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72417983 missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72430139 missense possibly damaging 0.57
R6223:Ggcx UTSW 6 72429605 missense probably damaging 0.97
R6515:Ggcx UTSW 6 72425832 missense probably benign 0.33
R7205:Ggcx UTSW 6 72428004 missense probably damaging 1.00
R7923:Ggcx UTSW 6 72427917 missense probably damaging 1.00
R8034:Ggcx UTSW 6 72428604 missense possibly damaging 0.47
R8096:Ggcx UTSW 6 72429993 missense probably benign 0.33
R8116:Ggcx UTSW 6 72429528 missense possibly damaging 0.66
R8356:Ggcx UTSW 6 72429591 missense probably benign 0.03
R9074:Ggcx UTSW 6 72425941 missense probably damaging 1.00
R9145:Ggcx UTSW 6 72425922 missense probably benign 0.18
R9285:Ggcx UTSW 6 72418419 nonsense probably null
R9362:Ggcx UTSW 6 72428032 missense probably damaging 1.00
R9497:Ggcx UTSW 6 72429207 missense probably damaging 1.00
Z1177:Ggcx UTSW 6 72426519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGCCTAGCTAGGGACGTTAGAG -3'
(R):5'- CCCTTCCAAAAGAGGCTGAAG -3'

Sequencing Primer
(F):5'- AGAGTGAAACGTGTCCTTTGTTCC -3'
(R):5'- CCTTCCAAAAGAGGCTGAAGTTCTG -3'
Posted On 2021-10-11