Incidental Mutation 'R8977:Mdga2'
ID 683522
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 068715-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8977 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66844409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 196 (D196E)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect possibly damaging
Transcript: ENSMUST00000037181
AA Change: D196E

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: D196E

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: D186E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: D127E

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: D127E

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A G 11: 58,184,710 (GRCm39) E476G unknown Het
Aars1 G A 8: 111,766,849 (GRCm39) R77Q probably damaging Het
Abcc10 C A 17: 46,624,593 (GRCm39) V795L probably benign Het
Adam30 A G 3: 98,069,378 (GRCm39) K276E probably damaging Het
Adam6b A T 12: 113,453,996 (GRCm39) N271I probably benign Het
Adgrl2 T C 3: 148,660,223 (GRCm39) I17V probably null Het
Anapc1 C A 2: 128,483,322 (GRCm39) G1258C probably damaging Het
Ank2 G T 3: 126,738,575 (GRCm39) H2436Q unknown Het
Ankrd13a A T 5: 114,933,806 (GRCm39) K267* probably null Het
Apob T C 12: 8,065,990 (GRCm39) Y4320H probably damaging Het
Atp2b2 T C 6: 113,750,325 (GRCm39) D678G probably damaging Het
Bhlhe41 C A 6: 145,809,096 (GRCm39) V239F possibly damaging Het
Cbfa2t2 T G 2: 154,342,410 (GRCm39) L42R probably benign Het
Ccer2 G A 7: 28,456,113 (GRCm39) V52M probably damaging Het
Ccnj T C 19: 40,833,383 (GRCm39) F187S probably damaging Het
Cd109 G A 9: 78,614,810 (GRCm39) V1286I probably benign Het
Cfap210 T C 2: 69,617,643 (GRCm39) H46R possibly damaging Het
Cfap46 G T 7: 139,259,849 (GRCm39) T148N probably benign Het
Chmp7 A G 14: 69,958,684 (GRCm39) V210A probably benign Het
Cuzd1 A G 7: 130,923,754 (GRCm39) F8S probably benign Het
Dnmbp A T 19: 43,840,751 (GRCm39) D549E probably damaging Het
Dpp4 A G 2: 62,204,747 (GRCm39) L240P probably benign Het
Dst A T 1: 34,286,864 (GRCm39) R3398S probably damaging Het
Eml6 A G 11: 29,734,182 (GRCm39) I1186T possibly damaging Het
Extl1 T C 4: 134,086,435 (GRCm39) E540G possibly damaging Het
Gdpd5 A G 7: 99,103,057 (GRCm39) I339V probably benign Het
Ggcx T C 6: 72,406,265 (GRCm39) probably null Het
Gm9195 A G 14: 72,691,338 (GRCm39) F1637L unknown Het
Igkv5-48 G C 6: 69,703,616 (GRCm39) N96K possibly damaging Het
Itga11 T C 9: 62,662,922 (GRCm39) I546T probably damaging Het
Map3k5 T A 10: 19,955,000 (GRCm39) F624L possibly damaging Het
Map7 T A 10: 20,145,336 (GRCm39) probably null Het
Mettl2 T C 11: 105,019,791 (GRCm39) C143R probably benign Het
Mmut G T 17: 41,249,481 (GRCm39) R152L probably benign Het
Ncam1 G T 9: 49,418,825 (GRCm39) T825K probably damaging Het
Nucb2 C A 7: 116,128,063 (GRCm39) N257K probably benign Het
Or1e19 A G 11: 73,316,651 (GRCm39) S53P probably benign Het
Or1p1c A T 11: 74,160,304 (GRCm39) I30F probably benign Het
Or2b7 T A 13: 21,740,016 (GRCm39) M59L possibly damaging Het
Or51i1 A T 7: 103,670,762 (GRCm39) Y254* probably null Het
Or52n1 A T 7: 104,383,248 (GRCm39) F108I probably damaging Het
Or8k38 C T 2: 86,488,472 (GRCm39) C110Y probably benign Het
Pamr1 T A 2: 102,441,963 (GRCm39) V184D probably damaging Het
Paqr9 A T 9: 95,442,888 (GRCm39) I293F possibly damaging Het
Pi15 G T 1: 17,690,126 (GRCm39) probably null Het
Pkm T A 9: 59,578,923 (GRCm39) I301N probably damaging Het
Pramel1 T A 4: 143,123,961 (GRCm39) I212N probably benign Het
Prdm6 A T 18: 53,701,373 (GRCm39) I549F probably damaging Het
Prpf8 A G 11: 75,386,870 (GRCm39) E1105G probably benign Het
Rad51b T A 12: 79,704,662 (GRCm39) V274E probably damaging Het
Rd3l T A 12: 111,946,593 (GRCm39) Y61F probably damaging Het
Resf1 T A 6: 149,229,906 (GRCm39) I984N probably damaging Het
Rgs11 T C 17: 26,427,233 (GRCm39) V388A probably damaging Het
Rictor A G 15: 6,812,566 (GRCm39) I901V probably benign Het
Riox2 A G 16: 59,312,195 (GRCm39) D444G probably benign Het
Scn2a T A 2: 65,594,014 (GRCm39) V1621E probably damaging Het
Sec11c A G 18: 65,945,818 (GRCm39) I94V possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Slc34a1 T C 13: 55,556,815 (GRCm39) I337T probably benign Het
Slc6a19 T C 13: 73,830,269 (GRCm39) K516E probably benign Het
Slco1b2 A T 6: 141,628,980 (GRCm39) M596L probably benign Het
Smarce1 A G 11: 99,110,511 (GRCm39) I100T possibly damaging Het
Stk32c A T 7: 138,705,161 (GRCm39) M119K possibly damaging Het
Tekt2 T C 4: 126,217,266 (GRCm39) probably null Het
Tenm4 A T 7: 96,461,177 (GRCm39) N908Y probably damaging Het
Tex38 A G 4: 115,637,792 (GRCm39) S4P probably benign Het
Top2b T A 14: 16,393,239 (GRCm38) H299Q probably benign Het
Trim55 C A 3: 19,713,341 (GRCm39) R131S probably benign Het
Vmn2r109 A T 17: 20,774,531 (GRCm39) Y275N possibly damaging Het
Vmn2r116 C T 17: 23,605,916 (GRCm39) T276I possibly damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TATACCTATCCATGTGCAGAAGC -3'
(R):5'- TCAGGTGGACCAAAACAGC -3'

Sequencing Primer
(F):5'- GGTCTAGCAAACTTTATATGCCCCAG -3'
(R):5'- CAGGAAGCGCCTCTGACAG -3'
Posted On 2021-10-11