Incidental Mutation 'R8977:Vmn2r109'
ID 683534
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8977 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20554269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 275 (Y275N)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect possibly damaging
Transcript: ENSMUST00000167093
AA Change: Y275N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: Y275N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,328,408 I984N probably damaging Het
4930438A08Rik A G 11: 58,293,884 E476G unknown Het
Aars G A 8: 111,040,217 R77Q probably damaging Het
Abcc10 C A 17: 46,313,667 V795L probably benign Het
Adam30 A G 3: 98,162,062 K276E probably damaging Het
Adam6b A T 12: 113,490,376 N271I probably benign Het
Adgrl2 T C 3: 148,954,587 I17V probably null Het
Anapc1 C A 2: 128,641,402 G1258C probably damaging Het
Ank2 G T 3: 126,944,926 H2436Q unknown Het
Ankrd13a A T 5: 114,795,745 K267* probably null Het
Apob T C 12: 8,015,990 Y4320H probably damaging Het
Atp2b2 T C 6: 113,773,364 D678G probably damaging Het
Bhlhe41 C A 6: 145,863,370 V239F possibly damaging Het
Cbfa2t2 T G 2: 154,500,490 L42R probably benign Het
Ccdc173 T C 2: 69,787,299 H46R possibly damaging Het
Ccer2 G A 7: 28,756,688 V52M probably damaging Het
Ccnj T C 19: 40,844,939 F187S probably damaging Het
Cd109 G A 9: 78,707,528 V1286I probably benign Het
Cfap46 G T 7: 139,679,933 T148N probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Cuzd1 A G 7: 131,322,025 F8S probably benign Het
Dnmbp A T 19: 43,852,312 D549E probably damaging Het
Dpp4 A G 2: 62,374,403 L240P probably benign Het
Dst A T 1: 34,247,783 R3398S probably damaging Het
Eml6 A G 11: 29,784,182 I1186T possibly damaging Het
Extl1 T C 4: 134,359,124 E540G possibly damaging Het
Gdpd5 A G 7: 99,453,850 I339V probably benign Het
Ggcx T C 6: 72,429,282 probably null Het
Gm9195 A G 14: 72,453,898 F1637L unknown Het
Igkv5-48 G C 6: 69,726,632 N96K possibly damaging Het
Itga11 T C 9: 62,755,640 I546T probably damaging Het
Map3k5 T A 10: 20,079,254 F624L possibly damaging Het
Map7 T A 10: 20,269,590 probably null Het
Mdga2 A T 12: 66,797,635 D196E possibly damaging Het
Mettl2 T C 11: 105,128,965 C143R probably benign Het
Mut G T 17: 40,938,590 R152L probably benign Het
Ncam1 G T 9: 49,507,525 T825K probably damaging Het
Nucb2 C A 7: 116,528,828 N257K probably benign Het
Olfr1085 C T 2: 86,658,128 C110Y probably benign Het
Olfr1535 T A 13: 21,555,846 M59L possibly damaging Het
Olfr378 A G 11: 73,425,825 S53P probably benign Het
Olfr406 A T 11: 74,269,478 I30F probably benign Het
Olfr640 A T 7: 104,021,555 Y254* probably null Het
Olfr664 A T 7: 104,734,041 F108I probably damaging Het
Pamr1 T A 2: 102,611,618 V184D probably damaging Het
Paqr9 A T 9: 95,560,835 I293F possibly damaging Het
Pi15 G T 1: 17,619,902 probably null Het
Pkm T A 9: 59,671,640 I301N probably damaging Het
Pramel1 T A 4: 143,397,391 I212N probably benign Het
Prdm6 A T 18: 53,568,301 I549F probably damaging Het
Prpf8 A G 11: 75,496,044 E1105G probably benign Het
Rad51b T A 12: 79,657,888 V274E probably damaging Het
Rd3l T A 12: 111,980,159 Y61F probably damaging Het
Rgs11 T C 17: 26,208,259 V388A probably damaging Het
Rictor A G 15: 6,783,085 I901V probably benign Het
Riox2 A G 16: 59,491,832 D444G probably benign Het
Scn2a T A 2: 65,763,670 V1621E probably damaging Het
Sec11c A G 18: 65,812,747 I94V possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc34a1 T C 13: 55,409,002 I337T probably benign Het
Slc6a19 T C 13: 73,682,150 K516E probably benign Het
Slco1b2 A T 6: 141,683,254 M596L probably benign Het
Smarce1 A G 11: 99,219,685 I100T possibly damaging Het
Stk32c A T 7: 139,125,245 M119K possibly damaging Het
Tekt2 T C 4: 126,323,473 probably null Het
Tenm4 A T 7: 96,811,970 N908Y probably damaging Het
Tex38 A G 4: 115,780,595 S4P probably benign Het
Top2b T A 14: 16,393,239 H299Q probably benign Het
Trim55 C A 3: 19,659,177 R131S probably benign Het
Vmn2r116 C T 17: 23,386,942 T276I possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGTCAGCCAACAGTTG -3'
(R):5'- GGTCTCATACTCCCAGATGATCAC -3'

Sequencing Primer
(F):5'- TGAAGAACAAATGCCATAACTTAGG -3'
(R):5'- TACTCCCAGATGATCACAAAGG -3'
Posted On 2021-10-11