Incidental Mutation 'R8977:Vmn2r109'
ID 683534
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 068715-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8977 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20774531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 275 (Y275N)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect possibly damaging
Transcript: ENSMUST00000167093
AA Change: Y275N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: Y275N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A G 11: 58,184,710 (GRCm39) E476G unknown Het
Aars1 G A 8: 111,766,849 (GRCm39) R77Q probably damaging Het
Abcc10 C A 17: 46,624,593 (GRCm39) V795L probably benign Het
Adam30 A G 3: 98,069,378 (GRCm39) K276E probably damaging Het
Adam6b A T 12: 113,453,996 (GRCm39) N271I probably benign Het
Adgrl2 T C 3: 148,660,223 (GRCm39) I17V probably null Het
Anapc1 C A 2: 128,483,322 (GRCm39) G1258C probably damaging Het
Ank2 G T 3: 126,738,575 (GRCm39) H2436Q unknown Het
Ankrd13a A T 5: 114,933,806 (GRCm39) K267* probably null Het
Apob T C 12: 8,065,990 (GRCm39) Y4320H probably damaging Het
Atp2b2 T C 6: 113,750,325 (GRCm39) D678G probably damaging Het
Bhlhe41 C A 6: 145,809,096 (GRCm39) V239F possibly damaging Het
Cbfa2t2 T G 2: 154,342,410 (GRCm39) L42R probably benign Het
Ccer2 G A 7: 28,456,113 (GRCm39) V52M probably damaging Het
Ccnj T C 19: 40,833,383 (GRCm39) F187S probably damaging Het
Cd109 G A 9: 78,614,810 (GRCm39) V1286I probably benign Het
Cfap210 T C 2: 69,617,643 (GRCm39) H46R possibly damaging Het
Cfap46 G T 7: 139,259,849 (GRCm39) T148N probably benign Het
Chmp7 A G 14: 69,958,684 (GRCm39) V210A probably benign Het
Cuzd1 A G 7: 130,923,754 (GRCm39) F8S probably benign Het
Dnmbp A T 19: 43,840,751 (GRCm39) D549E probably damaging Het
Dpp4 A G 2: 62,204,747 (GRCm39) L240P probably benign Het
Dst A T 1: 34,286,864 (GRCm39) R3398S probably damaging Het
Eml6 A G 11: 29,734,182 (GRCm39) I1186T possibly damaging Het
Extl1 T C 4: 134,086,435 (GRCm39) E540G possibly damaging Het
Gdpd5 A G 7: 99,103,057 (GRCm39) I339V probably benign Het
Ggcx T C 6: 72,406,265 (GRCm39) probably null Het
Gm9195 A G 14: 72,691,338 (GRCm39) F1637L unknown Het
Igkv5-48 G C 6: 69,703,616 (GRCm39) N96K possibly damaging Het
Itga11 T C 9: 62,662,922 (GRCm39) I546T probably damaging Het
Map3k5 T A 10: 19,955,000 (GRCm39) F624L possibly damaging Het
Map7 T A 10: 20,145,336 (GRCm39) probably null Het
Mdga2 A T 12: 66,844,409 (GRCm39) D196E possibly damaging Het
Mettl2 T C 11: 105,019,791 (GRCm39) C143R probably benign Het
Mmut G T 17: 41,249,481 (GRCm39) R152L probably benign Het
Ncam1 G T 9: 49,418,825 (GRCm39) T825K probably damaging Het
Nucb2 C A 7: 116,128,063 (GRCm39) N257K probably benign Het
Or1e19 A G 11: 73,316,651 (GRCm39) S53P probably benign Het
Or1p1c A T 11: 74,160,304 (GRCm39) I30F probably benign Het
Or2b7 T A 13: 21,740,016 (GRCm39) M59L possibly damaging Het
Or51i1 A T 7: 103,670,762 (GRCm39) Y254* probably null Het
Or52n1 A T 7: 104,383,248 (GRCm39) F108I probably damaging Het
Or8k38 C T 2: 86,488,472 (GRCm39) C110Y probably benign Het
Pamr1 T A 2: 102,441,963 (GRCm39) V184D probably damaging Het
Paqr9 A T 9: 95,442,888 (GRCm39) I293F possibly damaging Het
Pi15 G T 1: 17,690,126 (GRCm39) probably null Het
Pkm T A 9: 59,578,923 (GRCm39) I301N probably damaging Het
Pramel1 T A 4: 143,123,961 (GRCm39) I212N probably benign Het
Prdm6 A T 18: 53,701,373 (GRCm39) I549F probably damaging Het
Prpf8 A G 11: 75,386,870 (GRCm39) E1105G probably benign Het
Rad51b T A 12: 79,704,662 (GRCm39) V274E probably damaging Het
Rd3l T A 12: 111,946,593 (GRCm39) Y61F probably damaging Het
Resf1 T A 6: 149,229,906 (GRCm39) I984N probably damaging Het
Rgs11 T C 17: 26,427,233 (GRCm39) V388A probably damaging Het
Rictor A G 15: 6,812,566 (GRCm39) I901V probably benign Het
Riox2 A G 16: 59,312,195 (GRCm39) D444G probably benign Het
Scn2a T A 2: 65,594,014 (GRCm39) V1621E probably damaging Het
Sec11c A G 18: 65,945,818 (GRCm39) I94V possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Slc34a1 T C 13: 55,556,815 (GRCm39) I337T probably benign Het
Slc6a19 T C 13: 73,830,269 (GRCm39) K516E probably benign Het
Slco1b2 A T 6: 141,628,980 (GRCm39) M596L probably benign Het
Smarce1 A G 11: 99,110,511 (GRCm39) I100T possibly damaging Het
Stk32c A T 7: 138,705,161 (GRCm39) M119K possibly damaging Het
Tekt2 T C 4: 126,217,266 (GRCm39) probably null Het
Tenm4 A T 7: 96,461,177 (GRCm39) N908Y probably damaging Het
Tex38 A G 4: 115,637,792 (GRCm39) S4P probably benign Het
Top2b T A 14: 16,393,239 (GRCm38) H299Q probably benign Het
Trim55 C A 3: 19,713,341 (GRCm39) R131S probably benign Het
Vmn2r116 C T 17: 23,605,916 (GRCm39) T276I possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20,761,189 (GRCm39) missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20,774,567 (GRCm39) missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20,761,225 (GRCm39) missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20,774,729 (GRCm39) missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R9687:Vmn2r109 UTSW 17 20,775,332 (GRCm39) missense
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGTCAGCCAACAGTTG -3'
(R):5'- GGTCTCATACTCCCAGATGATCAC -3'

Sequencing Primer
(F):5'- TGAAGAACAAATGCCATAACTTAGG -3'
(R):5'- TACTCCCAGATGATCACAAAGG -3'
Posted On 2021-10-11