Mutagenetix > Incidental Mutation

Incidental Mutation 'R8977:Vmn2r116'

683535

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R8977 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23386942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 276 (T276I)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164856
AA Change: T276I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: T276I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,328,408	I984N	probably damaging	Het
4930438A08Rik	A	G	11: 58,293,884	E476G	unknown	Het
Aars	G	A	8: 111,040,217	R77Q	probably damaging	Het
Abcc10	C	A	17: 46,313,667	V795L	probably benign	Het
Adam30	A	G	3: 98,162,062	K276E	probably damaging	Het
Adam6b	A	T	12: 113,490,376	N271I	probably benign	Het
Adgrl2	T	C	3: 148,954,587	I17V	probably null	Het
Anapc1	C	A	2: 128,641,402	G1258C	probably damaging	Het
Ank2	G	T	3: 126,944,926	H2436Q	unknown	Het
Ankrd13a	A	T	5: 114,795,745	K267*	probably null	Het
Apob	T	C	12: 8,015,990	Y4320H	probably damaging	Het
Atp2b2	T	C	6: 113,773,364	D678G	probably damaging	Het
Bhlhe41	C	A	6: 145,863,370	V239F	possibly damaging	Het
Cbfa2t2	T	G	2: 154,500,490	L42R	probably benign	Het
Ccdc173	T	C	2: 69,787,299	H46R	possibly damaging	Het
Ccer2	G	A	7: 28,756,688	V52M	probably damaging	Het
Ccnj	T	C	19: 40,844,939	F187S	probably damaging	Het
Cd109	G	A	9: 78,707,528	V1286I	probably benign	Het
Cfap46	G	T	7: 139,679,933	T148N	probably benign	Het
Chmp7	A	G	14: 69,721,235	V210A	probably benign	Het
Cuzd1	A	G	7: 131,322,025	F8S	probably benign	Het
Dnmbp	A	T	19: 43,852,312	D549E	probably damaging	Het
Dpp4	A	G	2: 62,374,403	L240P	probably benign	Het
Dst	A	T	1: 34,247,783	R3398S	probably damaging	Het
Eml6	A	G	11: 29,784,182	I1186T	possibly damaging	Het
Extl1	T	C	4: 134,359,124	E540G	possibly damaging	Het
Gdpd5	A	G	7: 99,453,850	I339V	probably benign	Het
Ggcx	T	C	6: 72,429,282		probably null	Het
Gm9195	A	G	14: 72,453,898	F1637L	unknown	Het
Igkv5-48	G	C	6: 69,726,632	N96K	possibly damaging	Het
Itga11	T	C	9: 62,755,640	I546T	probably damaging	Het
Map3k5	T	A	10: 20,079,254	F624L	possibly damaging	Het
Map7	T	A	10: 20,269,590		probably null	Het
Mdga2	A	T	12: 66,797,635	D196E	possibly damaging	Het
Mettl2	T	C	11: 105,128,965	C143R	probably benign	Het
Mut	G	T	17: 40,938,590	R152L	probably benign	Het
Ncam1	G	T	9: 49,507,525	T825K	probably damaging	Het
Nucb2	C	A	7: 116,528,828	N257K	probably benign	Het
Olfr1085	C	T	2: 86,658,128	C110Y	probably benign	Het
Olfr1535	T	A	13: 21,555,846	M59L	possibly damaging	Het
Olfr378	A	G	11: 73,425,825	S53P	probably benign	Het
Olfr406	A	T	11: 74,269,478	I30F	probably benign	Het
Olfr640	A	T	7: 104,021,555	Y254*	probably null	Het
Olfr664	A	T	7: 104,734,041	F108I	probably damaging	Het
Pamr1	T	A	2: 102,611,618	V184D	probably damaging	Het
Paqr9	A	T	9: 95,560,835	I293F	possibly damaging	Het
Pi15	G	T	1: 17,619,902		probably null	Het
Pkm	T	A	9: 59,671,640	I301N	probably damaging	Het
Pramel1	T	A	4: 143,397,391	I212N	probably benign	Het
Prdm6	A	T	18: 53,568,301	I549F	probably damaging	Het
Prpf8	A	G	11: 75,496,044	E1105G	probably benign	Het
Rad51b	T	A	12: 79,657,888	V274E	probably damaging	Het
Rd3l	T	A	12: 111,980,159	Y61F	probably damaging	Het
Rgs11	T	C	17: 26,208,259	V388A	probably damaging	Het
Rictor	A	G	15: 6,783,085	I901V	probably benign	Het
Riox2	A	G	16: 59,491,832	D444G	probably benign	Het
Scn2a	T	A	2: 65,763,670	V1621E	probably damaging	Het
Sec11c	A	G	18: 65,812,747	I94V	possibly damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc34a1	T	C	13: 55,409,002	I337T	probably benign	Het
Slc6a19	T	C	13: 73,682,150	K516E	probably benign	Het
Slco1b2	A	T	6: 141,683,254	M596L	probably benign	Het
Smarce1	A	G	11: 99,219,685	I100T	possibly damaging	Het
Stk32c	A	T	7: 139,125,245	M119K	possibly damaging	Het
Tekt2	T	C	4: 126,323,473		probably null	Het
Tenm4	A	T	7: 96,811,970	N908Y	probably damaging	Het
Tex38	A	G	4: 115,780,595	S4P	probably benign	Het
Top2b	T	A	14: 16,393,239	H299Q	probably benign	Het
Trim55	C	A	3: 19,659,177	R131S	probably benign	Het
Vmn2r109	A	T	17: 20,554,269	Y275N	possibly damaging	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8950:Vmn2r116	UTSW	17	23401493	missense	probably damaging	1.00
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTAGGGTTGGTCATCTCAGAC -3'
(R):5'- TTTGACAGAGTTCAATGTCTGGAC -3'

Sequencing Primer
(F):5'- GTTGGTCATCTCAGACAGTGATCAAG -3'
(R):5'- GTCTGGACAAAATGTTTAAACCCAG -3'

Posted On

2021-10-11