Incidental Mutation 'R8978:Hspg2'
ID 683555
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, per, perlecan, Pcn
MMRRC Submission 068811-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8978 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137196080-137297941 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137291341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3897 (D3897G)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: D3889G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: D3889G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171332
AA Change: D3897G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: D3897G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,192,395 (GRCm39) F224L probably benign Het
Adam39 A G 8: 41,278,707 (GRCm39) D366G probably damaging Het
Adamts14 T A 10: 61,038,795 (GRCm39) E902V probably damaging Het
Adamts6 T C 13: 104,512,247 (GRCm39) C490R probably damaging Het
Btbd3 T C 2: 138,126,055 (GRCm39) V413A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cdadc1 G T 14: 59,813,197 (GRCm39) N403K probably damaging Het
Cdc27 C T 11: 104,399,211 (GRCm39) V734I possibly damaging Het
Celf3 A G 3: 94,392,667 (GRCm39) D122G probably benign Het
Chgb T C 2: 132,634,498 (GRCm39) S147P probably benign Het
Col9a1 G A 1: 24,278,396 (GRCm39) G808D probably damaging Het
Cpne7 A G 8: 123,861,177 (GRCm39) probably null Het
Crhr1 T C 11: 104,064,480 (GRCm39) F330S possibly damaging Het
Csmd1 A C 8: 15,971,056 (GRCm39) N3086K probably benign Het
Ctnnb1 A G 9: 120,786,650 (GRCm39) D624G probably damaging Het
Dcaf8 G A 1: 172,022,124 (GRCm39) R554H probably benign Het
Dmbt1 T C 7: 130,639,611 (GRCm39) Y50H possibly damaging Het
Dmxl1 T C 18: 50,055,679 (GRCm39) L2573P probably benign Het
Ebf2 G A 14: 67,661,548 (GRCm39) G559S probably benign Het
Fancd2 A G 6: 113,562,507 (GRCm39) probably benign Het
Fkbp10 A T 11: 100,313,936 (GRCm39) I427F probably benign Het
Gipc1 T C 8: 84,389,046 (GRCm39) probably null Het
Gm1110 A T 9: 26,807,095 (GRCm39) probably benign Het
Gsdmc3 A G 15: 63,731,455 (GRCm39) L359P probably damaging Het
Ift122 T A 6: 115,902,769 (GRCm39) M1117K possibly damaging Het
Itgbl1 A T 14: 124,209,617 (GRCm39) D456V probably damaging Het
Itprid2 T A 2: 79,491,257 (GRCm39) L1014Q probably damaging Het
Kctd1 G T 18: 15,119,491 (GRCm39) L675I Het
Kyat3 C T 3: 142,443,596 (GRCm39) T403M probably benign Het
Ltbp2 T C 12: 84,834,164 (GRCm39) T1442A probably benign Het
Mier2 A C 10: 79,376,790 (GRCm39) S45R unknown Het
Mon2 T A 10: 122,871,469 (GRCm39) K383* probably null Het
Mroh4 G T 15: 74,499,473 (GRCm39) T136K probably benign Het
Mtif3 A T 5: 146,895,846 (GRCm39) S80R probably benign Het
Myh2 A C 11: 67,068,188 (GRCm39) E272A probably damaging Het
Myh2 A G 11: 67,080,323 (GRCm39) Q1179R probably damaging Het
Nfatc3 G A 8: 106,835,402 (GRCm39) C916Y probably benign Het
Or13a17 A T 7: 140,271,642 (GRCm39) T275S probably benign Het
Or2w2 T A 13: 21,758,279 (GRCm39) T116S probably benign Het
Or7g21 T A 9: 19,032,582 (GRCm39) C107* probably null Het
Orc2 T C 1: 58,511,499 (GRCm39) D370G possibly damaging Het
Pate7 A T 9: 35,688,069 (GRCm39) probably benign Het
Pcdhga6 T A 18: 37,840,716 (GRCm39) N145K probably benign Het
Pih1d2 A G 9: 50,536,232 (GRCm39) M296V probably benign Het
Prickle4 A T 17: 47,999,772 (GRCm39) probably benign Het
Rabl6 G A 2: 25,477,541 (GRCm39) P303L probably damaging Het
Rara T G 11: 98,862,595 (GRCm39) I332S probably damaging Het
Reln A G 5: 22,090,512 (GRCm39) F3449L possibly damaging Het
Rhoq T C 17: 87,271,767 (GRCm39) L61P Het
Rigi A G 4: 40,239,650 (GRCm39) I16T probably damaging Het
Slc6a15 G A 10: 103,230,953 (GRCm39) W226* probably null Het
Spef2 A T 15: 9,725,263 (GRCm39) S165T possibly damaging Het
Stab2 T C 10: 86,785,782 (GRCm39) N620S possibly damaging Het
Suds3 A G 5: 117,232,973 (GRCm39) probably null Het
Sult1b1 A G 5: 87,682,900 (GRCm39) I15T possibly damaging Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tgfbi C A 13: 56,778,391 (GRCm39) D387E probably benign Het
Thrb T C 14: 17,981,886 (GRCm38) C4R possibly damaging Het
Tk2 A G 8: 104,957,809 (GRCm39) V179A possibly damaging Het
Trim25 T C 11: 88,907,027 (GRCm39) V462A probably benign Het
Tub T C 7: 108,629,393 (GRCm39) Y483H probably damaging Het
Vav1 A G 17: 57,603,710 (GRCm39) T131A probably benign Het
Vav1 A G 17: 57,631,650 (GRCm39) T781A probably benign Het
Zbtb34 A G 2: 33,301,048 (GRCm39) S498P possibly damaging Het
Zfp568 T A 7: 29,716,683 (GRCm39) H194Q probably benign Het
Zfp683 A T 4: 133,781,239 (GRCm39) Q18L probably benign Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,256,131 (GRCm39) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,266,506 (GRCm39) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,289,512 (GRCm39) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,269,901 (GRCm39) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,286,646 (GRCm39) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,273,969 (GRCm39) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,267,625 (GRCm39) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,265,800 (GRCm39) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,281,128 (GRCm39) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,247,017 (GRCm39) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,266,494 (GRCm39) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,280,114 (GRCm39) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,242,084 (GRCm39) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,292,237 (GRCm39) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,239,982 (GRCm39) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,289,237 (GRCm39) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,267,384 (GRCm39) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,279,565 (GRCm39) missense probably benign
IGL02051:Hspg2 APN 4 137,295,700 (GRCm39) unclassified probably benign
IGL02124:Hspg2 APN 4 137,246,125 (GRCm39) splice site probably null
IGL02128:Hspg2 APN 4 137,291,327 (GRCm39) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,242,627 (GRCm39) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,245,956 (GRCm39) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,237,888 (GRCm39) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,235,700 (GRCm39) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,271,823 (GRCm39) splice site probably benign
IGL02514:Hspg2 APN 4 137,296,887 (GRCm39) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,271,731 (GRCm39) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,239,953 (GRCm39) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,279,159 (GRCm39) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,284,756 (GRCm39) splice site probably benign
IGL02701:Hspg2 APN 4 137,284,485 (GRCm39) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,282,441 (GRCm39) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,235,114 (GRCm39) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,289,136 (GRCm39) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,243,248 (GRCm39) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,287,833 (GRCm39) splice site probably benign
G1patch:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,277,684 (GRCm39) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,247,242 (GRCm39) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,270,160 (GRCm39) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,289,512 (GRCm39) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,238,469 (GRCm39) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,242,734 (GRCm39) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,260,840 (GRCm39) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,277,335 (GRCm39) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,229,605 (GRCm39) missense probably benign
R0599:Hspg2 UTSW 4 137,239,712 (GRCm39) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,280,591 (GRCm39) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,239,660 (GRCm39) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,268,751 (GRCm39) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,267,411 (GRCm39) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,244,947 (GRCm39) missense probably benign
R1497:Hspg2 UTSW 4 137,275,407 (GRCm39) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,238,552 (GRCm39) splice site probably benign
R1625:Hspg2 UTSW 4 137,246,282 (GRCm39) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,245,746 (GRCm39) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,260,748 (GRCm39) nonsense probably null
R1699:Hspg2 UTSW 4 137,275,323 (GRCm39) splice site probably null
R1703:Hspg2 UTSW 4 137,286,462 (GRCm39) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,241,984 (GRCm39) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,247,467 (GRCm39) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,245,820 (GRCm39) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,272,878 (GRCm39) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,292,801 (GRCm39) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,269,863 (GRCm39) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,292,206 (GRCm39) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,295,677 (GRCm39) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,286,678 (GRCm39) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,247,420 (GRCm39) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,244,915 (GRCm39) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,249,354 (GRCm39) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,276,885 (GRCm39) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,282,601 (GRCm39) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,292,815 (GRCm39) splice site probably benign
R3873:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,286,625 (GRCm39) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,283,968 (GRCm39) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,196,222 (GRCm39) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,256,729 (GRCm39) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,289,535 (GRCm39) missense probably benign
R4421:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,266,886 (GRCm39) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,273,884 (GRCm39) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,261,041 (GRCm39) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,266,956 (GRCm39) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,249,438 (GRCm39) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,297,384 (GRCm39) unclassified probably benign
R4793:Hspg2 UTSW 4 137,256,784 (GRCm39) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,292,706 (GRCm39) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,268,977 (GRCm39) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,269,841 (GRCm39) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,235,342 (GRCm39) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,239,237 (GRCm39) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,271,225 (GRCm39) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,256,105 (GRCm39) splice site probably null
R5529:Hspg2 UTSW 4 137,279,139 (GRCm39) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,270,136 (GRCm39) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,247,862 (GRCm39) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,275,485 (GRCm39) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,270,077 (GRCm39) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,289,032 (GRCm39) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,281,093 (GRCm39) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,268,046 (GRCm39) missense probably benign
R6164:Hspg2 UTSW 4 137,241,966 (GRCm39) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,296,829 (GRCm39) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,267,559 (GRCm39) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,246,997 (GRCm39) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,272,016 (GRCm39) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,289,266 (GRCm39) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,269,006 (GRCm39) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,266,707 (GRCm39) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,235,112 (GRCm39) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,282,586 (GRCm39) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,293,048 (GRCm39) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,279,114 (GRCm39) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,235,709 (GRCm39) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,268,031 (GRCm39) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,246,600 (GRCm39) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,262,467 (GRCm39) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,256,201 (GRCm39) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,269,580 (GRCm39) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,271,677 (GRCm39) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,237,963 (GRCm39) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,279,427 (GRCm39) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,242,030 (GRCm39) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,260,872 (GRCm39) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,235,704 (GRCm39) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,247,257 (GRCm39) missense probably benign 0.15
R7278:Hspg2 UTSW 4 137,278,436 (GRCm39) missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137,256,867 (GRCm39) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,266,490 (GRCm39) missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137,242,975 (GRCm39) missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137,266,714 (GRCm39) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,269,931 (GRCm39) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,268,751 (GRCm39) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,284,503 (GRCm39) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,275,679 (GRCm39) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,292,249 (GRCm39) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,239,277 (GRCm39) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,239,177 (GRCm39) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,239,775 (GRCm39) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,286,160 (GRCm39) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,292,135 (GRCm39) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,244,148 (GRCm39) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,275,427 (GRCm39) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,278,243 (GRCm39) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,282,532 (GRCm39) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,235,333 (GRCm39) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,239,974 (GRCm39) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,266,986 (GRCm39) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,271,681 (GRCm39) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,278,178 (GRCm39) nonsense probably null
R8491:Hspg2 UTSW 4 137,281,030 (GRCm39) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,266,759 (GRCm39) missense probably damaging 0.98
R9152:Hspg2 UTSW 4 137,249,876 (GRCm39) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,270,185 (GRCm39) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,256,657 (GRCm39) missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137,289,790 (GRCm39) missense probably benign 0.05
R9221:Hspg2 UTSW 4 137,287,726 (GRCm39) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,265,552 (GRCm39) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,278,480 (GRCm39) missense probably benign
R9340:Hspg2 UTSW 4 137,296,827 (GRCm39) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,244,909 (GRCm39) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,238,380 (GRCm39) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,268,072 (GRCm39) missense probably benign
R9656:Hspg2 UTSW 4 137,279,196 (GRCm39) missense probably benign
R9664:Hspg2 UTSW 4 137,266,887 (GRCm39) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,265,701 (GRCm39) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,239,962 (GRCm39) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,277,702 (GRCm39) missense probably benign
Z1177:Hspg2 UTSW 4 137,295,684 (GRCm39) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,291,829 (GRCm39) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,277,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACACTTTGGACCTCAGC -3'
(R):5'- GAATCTTAGGACCAGCCCTG -3'

Sequencing Primer
(F):5'- ACTTTGGACCTCAGCCCCAG -3'
(R):5'- GACAGAAATCCTCTTGGGGAACC -3'
Posted On 2021-10-11