Incidental Mutation 'R8978:Ift122'
ID 683560
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8978 (G1)
Quality Score 202.009
Status Not validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115925808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1117 (M1117K)
Ref Sequence ENSEMBL: ENSMUSP00000108547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038234
AA Change: M1118K

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: M1118K

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: M1176K

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112925
AA Change: M1117K

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: M1117K

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,281,098 F224L probably benign Het
Adam39 A G 8: 40,825,670 D366G probably damaging Het
Adamts14 T A 10: 61,203,016 E902V probably damaging Het
Adamts6 T C 13: 104,375,739 C490R probably damaging Het
Btbd3 T C 2: 138,284,135 V413A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdadc1 G T 14: 59,575,748 N403K probably damaging Het
Cdc27 C T 11: 104,508,385 V734I possibly damaging Het
Celf3 A G 3: 94,485,360 D122G probably benign Het
Chgb T C 2: 132,792,578 S147P probably benign Het
Col9a1 G A 1: 24,239,315 G808D probably damaging Het
Cpne7 A G 8: 123,134,438 probably null Het
Crhr1 T C 11: 104,173,654 F330S possibly damaging Het
Csmd1 A C 8: 15,921,056 N3086K probably benign Het
Ctnnb1 A G 9: 120,957,584 D624G probably damaging Het
Dcaf8 G A 1: 172,194,557 R554H probably benign Het
Ddx58 A G 4: 40,239,650 I16T probably damaging Het
Dmbt1 T C 7: 131,037,881 Y50H possibly damaging Het
Dmxl1 T C 18: 49,922,612 L2573P probably benign Het
Ebf2 G A 14: 67,424,099 G559S probably benign Het
Fkbp10 A T 11: 100,423,110 I427F probably benign Het
Gipc1 T C 8: 83,662,417 probably null Het
Gsdmc3 A G 15: 63,859,606 L359P probably damaging Het
Hspg2 A G 4: 137,564,030 D3897G probably benign Het
Itgbl1 A T 14: 123,972,205 D456V probably damaging Het
Kctd1 G T 18: 14,986,434 L675I Het
Kyat3 C T 3: 142,737,835 T403M probably benign Het
Ltbp2 T C 12: 84,787,390 T1442A probably benign Het
Mier2 A C 10: 79,540,956 S45R unknown Het
Mon2 T A 10: 123,035,564 K383* probably null Het
Mroh4 G T 15: 74,627,624 T136K probably benign Het
Mtif3 A T 5: 146,959,036 S80R probably benign Het
Myh2 A C 11: 67,177,362 E272A probably damaging Het
Myh2 A G 11: 67,189,497 Q1179R probably damaging Het
Nfatc3 G A 8: 106,108,770 C916Y probably benign Het
Olfr1364 T A 13: 21,574,109 T116S probably benign Het
Olfr45 A T 7: 140,691,729 T275S probably benign Het
Olfr836 T A 9: 19,121,286 C107* probably null Het
Orc2 T C 1: 58,472,340 D370G possibly damaging Het
Pcdhga6 T A 18: 37,707,663 N145K probably benign Het
Pih1d2 A G 9: 50,624,932 M296V probably benign Het
Rabl6 G A 2: 25,587,529 P303L probably damaging Het
Rara T G 11: 98,971,769 I332S probably damaging Het
Reln A G 5: 21,885,514 F3449L possibly damaging Het
Rhoq T C 17: 86,964,339 L61P Het
Slc6a15 G A 10: 103,395,092 W226* probably null Het
Spef2 A T 15: 9,725,177 S165T possibly damaging Het
Ssfa2 T A 2: 79,660,913 L1014Q probably damaging Het
Stab2 T C 10: 86,949,918 N620S possibly damaging Het
Suds3 A G 5: 117,094,908 probably null Het
Sult1b1 A G 5: 87,535,041 I15T possibly damaging Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tgfbi C A 13: 56,630,578 D387E probably benign Het
Thrb T C 14: 17,981,886 C4R possibly damaging Het
Tk2 A G 8: 104,231,177 V179A possibly damaging Het
Trim25 T C 11: 89,016,201 V462A probably benign Het
Tub T C 7: 109,030,186 Y483H probably damaging Het
Vav1 A G 17: 57,296,710 T131A probably benign Het
Vav1 A G 17: 57,324,650 T781A probably benign Het
Zbtb34 A G 2: 33,411,036 S498P possibly damaging Het
Zfp568 T A 7: 30,017,258 H194Q probably benign Het
Zfp683 A T 4: 134,053,928 Q18L probably benign Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTTCTGAGAGCACTCCAG -3'
(R):5'- CCCAGCTTCCCAAAGGAGATAG -3'

Sequencing Primer
(F):5'- GCAGGGAGCATGTTACTGTTAG -3'
(R):5'- CTTCCCAAAGGAGATAGGGAGAATG -3'
Posted On 2021-10-11