Incidental Mutation 'R8978:Slc6a15'
ID 683579
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 068811-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8978 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 103230953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 226 (W226*)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]
AlphaFold Q8BG16
Predicted Effect probably null
Transcript: ENSMUST00000074204
AA Change: W226*
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: W226*

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179636
AA Change: W226*
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: W226*

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217905
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,192,395 (GRCm39) F224L probably benign Het
Adam39 A G 8: 41,278,707 (GRCm39) D366G probably damaging Het
Adamts14 T A 10: 61,038,795 (GRCm39) E902V probably damaging Het
Adamts6 T C 13: 104,512,247 (GRCm39) C490R probably damaging Het
Btbd3 T C 2: 138,126,055 (GRCm39) V413A possibly damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cdadc1 G T 14: 59,813,197 (GRCm39) N403K probably damaging Het
Cdc27 C T 11: 104,399,211 (GRCm39) V734I possibly damaging Het
Celf3 A G 3: 94,392,667 (GRCm39) D122G probably benign Het
Chgb T C 2: 132,634,498 (GRCm39) S147P probably benign Het
Col9a1 G A 1: 24,278,396 (GRCm39) G808D probably damaging Het
Cpne7 A G 8: 123,861,177 (GRCm39) probably null Het
Crhr1 T C 11: 104,064,480 (GRCm39) F330S possibly damaging Het
Csmd1 A C 8: 15,971,056 (GRCm39) N3086K probably benign Het
Ctnnb1 A G 9: 120,786,650 (GRCm39) D624G probably damaging Het
Dcaf8 G A 1: 172,022,124 (GRCm39) R554H probably benign Het
Dmbt1 T C 7: 130,639,611 (GRCm39) Y50H possibly damaging Het
Dmxl1 T C 18: 50,055,679 (GRCm39) L2573P probably benign Het
Ebf2 G A 14: 67,661,548 (GRCm39) G559S probably benign Het
Fancd2 A G 6: 113,562,507 (GRCm39) probably benign Het
Fkbp10 A T 11: 100,313,936 (GRCm39) I427F probably benign Het
Gipc1 T C 8: 84,389,046 (GRCm39) probably null Het
Gm1110 A T 9: 26,807,095 (GRCm39) probably benign Het
Gsdmc3 A G 15: 63,731,455 (GRCm39) L359P probably damaging Het
Hspg2 A G 4: 137,291,341 (GRCm39) D3897G probably benign Het
Ift122 T A 6: 115,902,769 (GRCm39) M1117K possibly damaging Het
Itgbl1 A T 14: 124,209,617 (GRCm39) D456V probably damaging Het
Itprid2 T A 2: 79,491,257 (GRCm39) L1014Q probably damaging Het
Kctd1 G T 18: 15,119,491 (GRCm39) L675I Het
Kyat3 C T 3: 142,443,596 (GRCm39) T403M probably benign Het
Ltbp2 T C 12: 84,834,164 (GRCm39) T1442A probably benign Het
Mier2 A C 10: 79,376,790 (GRCm39) S45R unknown Het
Mon2 T A 10: 122,871,469 (GRCm39) K383* probably null Het
Mroh4 G T 15: 74,499,473 (GRCm39) T136K probably benign Het
Mtif3 A T 5: 146,895,846 (GRCm39) S80R probably benign Het
Myh2 A C 11: 67,068,188 (GRCm39) E272A probably damaging Het
Myh2 A G 11: 67,080,323 (GRCm39) Q1179R probably damaging Het
Nfatc3 G A 8: 106,835,402 (GRCm39) C916Y probably benign Het
Or13a17 A T 7: 140,271,642 (GRCm39) T275S probably benign Het
Or2w2 T A 13: 21,758,279 (GRCm39) T116S probably benign Het
Or7g21 T A 9: 19,032,582 (GRCm39) C107* probably null Het
Orc2 T C 1: 58,511,499 (GRCm39) D370G possibly damaging Het
Pate7 A T 9: 35,688,069 (GRCm39) probably benign Het
Pcdhga6 T A 18: 37,840,716 (GRCm39) N145K probably benign Het
Pih1d2 A G 9: 50,536,232 (GRCm39) M296V probably benign Het
Prickle4 A T 17: 47,999,772 (GRCm39) probably benign Het
Rabl6 G A 2: 25,477,541 (GRCm39) P303L probably damaging Het
Rara T G 11: 98,862,595 (GRCm39) I332S probably damaging Het
Reln A G 5: 22,090,512 (GRCm39) F3449L possibly damaging Het
Rhoq T C 17: 87,271,767 (GRCm39) L61P Het
Rigi A G 4: 40,239,650 (GRCm39) I16T probably damaging Het
Spef2 A T 15: 9,725,263 (GRCm39) S165T possibly damaging Het
Stab2 T C 10: 86,785,782 (GRCm39) N620S possibly damaging Het
Suds3 A G 5: 117,232,973 (GRCm39) probably null Het
Sult1b1 A G 5: 87,682,900 (GRCm39) I15T possibly damaging Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tgfbi C A 13: 56,778,391 (GRCm39) D387E probably benign Het
Thrb T C 14: 17,981,886 (GRCm38) C4R possibly damaging Het
Tk2 A G 8: 104,957,809 (GRCm39) V179A possibly damaging Het
Trim25 T C 11: 88,907,027 (GRCm39) V462A probably benign Het
Tub T C 7: 108,629,393 (GRCm39) Y483H probably damaging Het
Vav1 A G 17: 57,603,710 (GRCm39) T131A probably benign Het
Vav1 A G 17: 57,631,650 (GRCm39) T781A probably benign Het
Zbtb34 A G 2: 33,301,048 (GRCm39) S498P possibly damaging Het
Zfp568 T A 7: 29,716,683 (GRCm39) H194Q probably benign Het
Zfp683 A T 4: 133,781,239 (GRCm39) Q18L probably benign Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTGGCTAATGGGCTTG -3'
(R):5'- TGTAGATGCCTAGACAAAGTAGTC -3'

Sequencing Primer
(F):5'- GCTAATGGGCTTGTGGGAC -3'
(R):5'- CAAACAATTTGTCATTTGAATTTGGG -3'
Posted On 2021-10-11