Mutagenetix > Incidental Mutation

Incidental Mutation 'R8978:Slc6a15'

683579

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8978 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 103395092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 226 (W226*)

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]

AlphaFold

Q8BG16

Predicted Effect

probably null
Transcript: ENSMUST00000074204
AA Change: W226*

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: W226*

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000179636
AA Change: W226*

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: W226*

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217905

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	A	G	9: 44,281,098	F224L	probably benign	Het
Adam39	A	G	8: 40,825,670	D366G	probably damaging	Het
Adamts14	T	A	10: 61,203,016	E902V	probably damaging	Het
Adamts6	T	C	13: 104,375,739	C490R	probably damaging	Het
Btbd3	T	C	2: 138,284,135	V413A	possibly damaging	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cdadc1	G	T	14: 59,575,748	N403K	probably damaging	Het
Cdc27	C	T	11: 104,508,385	V734I	possibly damaging	Het
Celf3	A	G	3: 94,485,360	D122G	probably benign	Het
Chgb	T	C	2: 132,792,578	S147P	probably benign	Het
Col9a1	G	A	1: 24,239,315	G808D	probably damaging	Het
Cpne7	A	G	8: 123,134,438		probably null	Het
Crhr1	T	C	11: 104,173,654	F330S	possibly damaging	Het
Csmd1	A	C	8: 15,921,056	N3086K	probably benign	Het
Ctnnb1	A	G	9: 120,957,584	D624G	probably damaging	Het
Dcaf8	G	A	1: 172,194,557	R554H	probably benign	Het
Ddx58	A	G	4: 40,239,650	I16T	probably damaging	Het
Dmbt1	T	C	7: 131,037,881	Y50H	possibly damaging	Het
Dmxl1	T	C	18: 49,922,612	L2573P	probably benign	Het
Ebf2	G	A	14: 67,424,099	G559S	probably benign	Het
Fancd2	A	G	6: 113,585,546		probably benign	Het
Fkbp10	A	T	11: 100,423,110	I427F	probably benign	Het
Gipc1	T	C	8: 83,662,417		probably null	Het
Gm1110	A	T	9: 26,895,799		probably benign	Het
Gm17727	A	T	9: 35,776,773		probably benign	Het
Gsdmc3	A	G	15: 63,859,606	L359P	probably damaging	Het
Hspg2	A	G	4: 137,564,030	D3897G	probably benign	Het
Ift122	T	A	6: 115,925,808	M1117K	possibly damaging	Het
Itgbl1	A	T	14: 123,972,205	D456V	probably damaging	Het
Kctd1	G	T	18: 14,986,434	L675I		Het
Kyat3	C	T	3: 142,737,835	T403M	probably benign	Het
Ltbp2	T	C	12: 84,787,390	T1442A	probably benign	Het
Mier2	A	C	10: 79,540,956	S45R	unknown	Het
Mon2	T	A	10: 123,035,564	K383*	probably null	Het
Mroh4	G	T	15: 74,627,624	T136K	probably benign	Het
Mtif3	A	T	5: 146,959,036	S80R	probably benign	Het
Myh2	A	C	11: 67,177,362	E272A	probably damaging	Het
Myh2	A	G	11: 67,189,497	Q1179R	probably damaging	Het
Nfatc3	G	A	8: 106,108,770	C916Y	probably benign	Het
Olfr1364	T	A	13: 21,574,109	T116S	probably benign	Het
Olfr45	A	T	7: 140,691,729	T275S	probably benign	Het
Olfr836	T	A	9: 19,121,286	C107*	probably null	Het
Orc2	T	C	1: 58,472,340	D370G	possibly damaging	Het
Pcdhga6	T	A	18: 37,707,663	N145K	probably benign	Het
Pih1d2	A	G	9: 50,624,932	M296V	probably benign	Het
Prickle4	A	T	17: 47,688,847		probably benign	Het
Rabl6	G	A	2: 25,587,529	P303L	probably damaging	Het
Rara	T	G	11: 98,971,769	I332S	probably damaging	Het
Reln	A	G	5: 21,885,514	F3449L	possibly damaging	Het
Rhoq	T	C	17: 86,964,339	L61P		Het
Spef2	A	T	15: 9,725,177	S165T	possibly damaging	Het
Ssfa2	T	A	2: 79,660,913	L1014Q	probably damaging	Het
Stab2	T	C	10: 86,949,918	N620S	possibly damaging	Het
Suds3	A	G	5: 117,094,908		probably null	Het
Sult1b1	A	G	5: 87,535,041	I15T	possibly damaging	Het
Synm	C	A	7: 67,734,924	V997L	probably damaging	Het
Tgfbi	C	A	13: 56,630,578	D387E	probably benign	Het
Thrb	T	C	14: 17,981,886	C4R	possibly damaging	Het
Tk2	A	G	8: 104,231,177	V179A	possibly damaging	Het
Trim25	T	C	11: 89,016,201	V462A	probably benign	Het
Tub	T	C	7: 109,030,186	Y483H	probably damaging	Het
Vav1	A	G	17: 57,296,710	T131A	probably benign	Het
Vav1	A	G	17: 57,324,650	T781A	probably benign	Het
Zbtb34	A	G	2: 33,411,036	S498P	possibly damaging	Het
Zfp568	T	A	7: 30,017,258	H194Q	probably benign	Het
Zfp683	A	T	4: 134,053,928	Q18L	probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACTGGCTAATGGGCTTG -3'
(R):5'- TGTAGATGCCTAGACAAAGTAGTC -3'

Sequencing Primer
(F):5'- GCTAATGGGCTTGTGGGAC -3'
(R):5'- CAAACAATTTGTCATTTGAATTTGGG -3'

Posted On

2021-10-11