Incidental Mutation 'R8979:Cntln'
ID 683618
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R8979 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85130673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 240 (V240E)
Ref Sequence ENSEMBL: ENSMUSP00000102808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: V1375E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V1375E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107190
AA Change: V240E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: V240E

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: V1374E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V1374E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A C 3: 60,025,124 R353S probably damaging Het
Ablim3 C T 18: 61,849,326 V183I probably benign Het
Adgrb3 T A 1: 25,488,034 Q607L probably benign Het
Adgrl1 A G 8: 83,938,386 D1234G probably benign Het
AI481877 T C 4: 59,047,276 T1448A possibly damaging Het
Alms1 A G 6: 85,621,027 Y945C probably damaging Het
Arhgef26 T A 3: 62,339,548 W18R possibly damaging Het
Caskin1 G T 17: 24,498,925 A229S possibly damaging Het
Celsr1 A T 15: 85,963,139 S1466T probably damaging Het
Cftr T C 6: 18,227,948 Y380H probably benign Het
Ciapin1 A T 8: 94,823,125 L301Q probably damaging Het
Clec1b A G 6: 129,403,574 E151G probably benign Het
Cngb1 G A 8: 95,278,285 probably benign Het
Cog5 A G 12: 31,790,895 T240A probably benign Het
Col5a3 G A 9: 20,775,301 P1343S unknown Het
Cspp1 T A 1: 10,064,405 S127T probably benign Het
Dnah9 T G 11: 66,005,152 M2466L probably benign Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw13 A T 9: 109,184,129 W247R probably damaging Het
Gbp4 G A 5: 105,119,382 T557M probably benign Het
Gm13762 C T 2: 88,973,829 V21I probably benign Het
Gm7102 A G 19: 61,175,731 Y89H probably damaging Het
Ide G A 19: 37,325,312 A133V Het
Il2rb C A 15: 78,491,852 probably benign Het
Itgb1 A G 8: 128,722,470 E519G probably benign Het
Kifc1 A G 17: 33,883,254 Y462H possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Llgl1 C T 11: 60,710,303 A689V probably benign Het
Lrrc37a C A 11: 103,503,007 V531L possibly damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mid1 G A X: 169,985,013 A386T probably benign Het
Mms22l C T 4: 24,580,070 L760F probably benign Het
Mst1r C T 9: 107,915,279 R951C probably damaging Het
Naalad2 G A 9: 18,330,850 T586M probably damaging Het
Oxct2b A G 4: 123,117,376 N363S probably benign Het
Padi6 T G 4: 140,739,163 N145T probably benign Het
Plcl2 T A 17: 50,640,117 M1008K possibly damaging Het
Plekha5 T C 6: 140,551,092 S435P probably damaging Het
Prkacb C A 3: 146,812,656 G10C probably benign Het
Psg29 A T 7: 17,203,619 probably benign Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Ptpro A G 6: 137,368,142 I49V probably benign Het
Rassf1 A G 9: 107,551,805 D70G probably benign Het
Rbm24 A T 13: 46,419,055 T9S probably damaging Het
Rp1 T C 1: 4,148,714 T948A unknown Het
Ryr2 A T 13: 11,595,038 C4301S probably benign Het
S100pbp T C 4: 129,182,340 D64G probably damaging Het
Samd3 A G 10: 26,244,530 K141E possibly damaging Het
Scgb1b29 A T 7: 32,441,852 K65* probably null Het
Slc51b T C 9: 65,412,928 N86D probably benign Het
Slc6a3 G A 13: 73,567,601 V452I probably benign Het
Sobp A G 10: 43,020,980 probably null Het
Spats2 T C 15: 99,212,242 S507P possibly damaging Het
Spns3 C T 11: 72,529,590 A357T probably damaging Het
Suox A T 10: 128,671,498 H220Q probably damaging Het
Tbc1d9b A T 11: 50,170,982 S1106C probably benign Het
Tbx1 T C 16: 18,587,995 D9G unknown Het
Tcaf2 A T 6: 42,624,470 F885Y probably damaging Het
Tgoln1 T C 6: 72,616,279 T73A probably benign Het
Tigd3 G A 19: 5,891,825 P426S probably benign Het
Tmem233 T A 5: 116,083,201 probably benign Het
Tnfrsf11a A G 1: 105,827,100 D299G possibly damaging Het
Trim32 T C 4: 65,613,455 V83A possibly damaging Het
Unc13a A T 8: 71,660,481 M242K probably benign Het
Vat1 C T 11: 101,462,215 G293D probably damaging Het
Vmn1r174 T A 7: 23,754,467 V186D possibly damaging Het
Wdfy3 A G 5: 101,948,898 Y345H probably damaging Het
Zzef1 C T 11: 72,875,177 T1510I probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9353:Cntln UTSW 4 84884360 unclassified probably benign
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9478:Cntln UTSW 4 84979393 missense probably benign 0.00
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
R9793:Cntln UTSW 4 85067561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGGTCCCATTATGACTTGAAAG -3'
(R):5'- TTATTTGGCTGGAGCTGCCC -3'

Sequencing Primer
(F):5'- GTCAGATGACAACTTTAGTCATCCG -3'
(R):5'- TGGAGCTGCCCATTGCTAG -3'
Posted On 2021-10-11