Incidental Mutation 'R8979:Padi6'
ID 683621
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8979 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 140739163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 145 (N145T)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably benign
Transcript: ENSMUST00000038749
AA Change: N145T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: N145T

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130267
AA Change: N70T

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935
AA Change: N70T

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A C 3: 60,025,124 R353S probably damaging Het
Ablim3 C T 18: 61,849,326 V183I probably benign Het
Adgrb3 T A 1: 25,488,034 Q607L probably benign Het
Adgrl1 A G 8: 83,938,386 D1234G probably benign Het
AI481877 T C 4: 59,047,276 T1448A possibly damaging Het
Alms1 A G 6: 85,621,027 Y945C probably damaging Het
Arhgef26 T A 3: 62,339,548 W18R possibly damaging Het
Caskin1 G T 17: 24,498,925 A229S possibly damaging Het
Celsr1 A T 15: 85,963,139 S1466T probably damaging Het
Cftr T C 6: 18,227,948 Y380H probably benign Het
Ciapin1 A T 8: 94,823,125 L301Q probably damaging Het
Clec1b A G 6: 129,403,574 E151G probably benign Het
Cngb1 G A 8: 95,278,285 probably benign Het
Cntln T A 4: 85,130,673 V240E probably damaging Het
Cog5 A G 12: 31,790,895 T240A probably benign Het
Col5a3 G A 9: 20,775,301 P1343S unknown Het
Cspp1 T A 1: 10,064,405 S127T probably benign Het
Dnah9 T G 11: 66,005,152 M2466L probably benign Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw13 A T 9: 109,184,129 W247R probably damaging Het
Gbp4 G A 5: 105,119,382 T557M probably benign Het
Gm13762 C T 2: 88,973,829 V21I probably benign Het
Gm7102 A G 19: 61,175,731 Y89H probably damaging Het
Ide G A 19: 37,325,312 A133V Het
Il2rb C A 15: 78,491,852 probably benign Het
Itgb1 A G 8: 128,722,470 E519G probably benign Het
Kifc1 A G 17: 33,883,254 Y462H possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Llgl1 C T 11: 60,710,303 A689V probably benign Het
Lrrc37a C A 11: 103,503,007 V531L possibly damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mid1 G A X: 169,985,013 A386T probably benign Het
Mms22l C T 4: 24,580,070 L760F probably benign Het
Mst1r C T 9: 107,915,279 R951C probably damaging Het
Naalad2 G A 9: 18,330,850 T586M probably damaging Het
Oxct2b A G 4: 123,117,376 N363S probably benign Het
Plcl2 T A 17: 50,640,117 M1008K possibly damaging Het
Plekha5 T C 6: 140,551,092 S435P probably damaging Het
Prkacb C A 3: 146,812,656 G10C probably benign Het
Psg29 A T 7: 17,203,619 probably benign Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Ptpro A G 6: 137,368,142 I49V probably benign Het
Rassf1 A G 9: 107,551,805 D70G probably benign Het
Rbm24 A T 13: 46,419,055 T9S probably damaging Het
Rp1 T C 1: 4,148,714 T948A unknown Het
Ryr2 A T 13: 11,595,038 C4301S probably benign Het
S100pbp T C 4: 129,182,340 D64G probably damaging Het
Samd3 A G 10: 26,244,530 K141E possibly damaging Het
Scgb1b29 A T 7: 32,441,852 K65* probably null Het
Slc51b T C 9: 65,412,928 N86D probably benign Het
Slc6a3 G A 13: 73,567,601 V452I probably benign Het
Sobp A G 10: 43,020,980 probably null Het
Spats2 T C 15: 99,212,242 S507P possibly damaging Het
Spns3 C T 11: 72,529,590 A357T probably damaging Het
Suox A T 10: 128,671,498 H220Q probably damaging Het
Tbc1d9b A T 11: 50,170,982 S1106C probably benign Het
Tbx1 T C 16: 18,587,995 D9G unknown Het
Tcaf2 A T 6: 42,624,470 F885Y probably damaging Het
Tgoln1 T C 6: 72,616,279 T73A probably benign Het
Tigd3 G A 19: 5,891,825 P426S probably benign Het
Tmem233 T A 5: 116,083,201 probably benign Het
Tnfrsf11a A G 1: 105,827,100 D299G possibly damaging Het
Trim32 T C 4: 65,613,455 V83A possibly damaging Het
Unc13a A T 8: 71,660,481 M242K probably benign Het
Vat1 C T 11: 101,462,215 G293D probably damaging Het
Vmn1r174 T A 7: 23,754,467 V186D possibly damaging Het
Wdfy3 A G 5: 101,948,898 Y345H probably damaging Het
Zzef1 C T 11: 72,875,177 T1510I probably benign Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCGGTCATCCACAAGG -3'
(R):5'- CTCTGTCCCTGCATTCGAGAAAC -3'

Sequencing Primer
(F):5'- GAAATCAGCCATGATCTGCGTGTG -3'
(R):5'- TGTCCCTGCATTCGAGAAACAAAAG -3'
Posted On 2021-10-11