Incidental Mutation 'R8979:Spats2'
ID 683662
Institutional Source Beutler Lab
Gene Symbol Spats2
Ensembl Gene ENSMUSG00000051934
Gene Name spermatogenesis associated, serine-rich 2
Synonyms Scr59, 59kDa, 2700012F11Rik, p59
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock # R8979 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99125916-99213215 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99212242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 507 (S507P)
Ref Sequence ENSEMBL: ENSMUSP00000070549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063517]
AlphaFold Q8K1N4
Predicted Effect possibly damaging
Transcript: ENSMUST00000063517
AA Change: S507P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070549
Gene: ENSMUSG00000051934
AA Change: S507P

DomainStartEndE-ValueType
Pfam:DUF1387 81 385 8.1e-125 PFAM
low complexity region 391 413 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A C 3: 60,025,124 R353S probably damaging Het
Ablim3 C T 18: 61,849,326 V183I probably benign Het
Adgrb3 T A 1: 25,488,034 Q607L probably benign Het
Adgrl1 A G 8: 83,938,386 D1234G probably benign Het
AI481877 T C 4: 59,047,276 T1448A possibly damaging Het
Alms1 A G 6: 85,621,027 Y945C probably damaging Het
Arhgef26 T A 3: 62,339,548 W18R possibly damaging Het
Caskin1 G T 17: 24,498,925 A229S possibly damaging Het
Celsr1 A T 15: 85,963,139 S1466T probably damaging Het
Cftr T C 6: 18,227,948 Y380H probably benign Het
Ciapin1 A T 8: 94,823,125 L301Q probably damaging Het
Clec1b A G 6: 129,403,574 E151G probably benign Het
Cngb1 G A 8: 95,278,285 probably benign Het
Cntln T A 4: 85,130,673 V240E probably damaging Het
Cog5 A G 12: 31,790,895 T240A probably benign Het
Col5a3 G A 9: 20,775,301 P1343S unknown Het
Cspp1 T A 1: 10,064,405 S127T probably benign Het
Dnah9 T G 11: 66,005,152 M2466L probably benign Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw13 A T 9: 109,184,129 W247R probably damaging Het
Gbp4 G A 5: 105,119,382 T557M probably benign Het
Gm13762 C T 2: 88,973,829 V21I probably benign Het
Gm7102 A G 19: 61,175,731 Y89H probably damaging Het
Ide G A 19: 37,325,312 A133V Het
Il2rb C A 15: 78,491,852 probably benign Het
Itgb1 A G 8: 128,722,470 E519G probably benign Het
Kifc1 A G 17: 33,883,254 Y462H possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Llgl1 C T 11: 60,710,303 A689V probably benign Het
Lrrc37a C A 11: 103,503,007 V531L possibly damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mid1 G A X: 169,985,013 A386T probably benign Het
Mms22l C T 4: 24,580,070 L760F probably benign Het
Mst1r C T 9: 107,915,279 R951C probably damaging Het
Naalad2 G A 9: 18,330,850 T586M probably damaging Het
Oxct2b A G 4: 123,117,376 N363S probably benign Het
Padi6 T G 4: 140,739,163 N145T probably benign Het
Plcl2 T A 17: 50,640,117 M1008K possibly damaging Het
Plekha5 T C 6: 140,551,092 S435P probably damaging Het
Prkacb C A 3: 146,812,656 G10C probably benign Het
Psg29 A T 7: 17,203,619 probably benign Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Ptpro A G 6: 137,368,142 I49V probably benign Het
Rassf1 A G 9: 107,551,805 D70G probably benign Het
Rbm24 A T 13: 46,419,055 T9S probably damaging Het
Rp1 T C 1: 4,148,714 T948A unknown Het
Ryr2 A T 13: 11,595,038 C4301S probably benign Het
S100pbp T C 4: 129,182,340 D64G probably damaging Het
Samd3 A G 10: 26,244,530 K141E possibly damaging Het
Scgb1b29 A T 7: 32,441,852 K65* probably null Het
Slc51b T C 9: 65,412,928 N86D probably benign Het
Slc6a3 G A 13: 73,567,601 V452I probably benign Het
Sobp A G 10: 43,020,980 probably null Het
Spns3 C T 11: 72,529,590 A357T probably damaging Het
Suox A T 10: 128,671,498 H220Q probably damaging Het
Tbc1d9b A T 11: 50,170,982 S1106C probably benign Het
Tbx1 T C 16: 18,587,995 D9G unknown Het
Tcaf2 A T 6: 42,624,470 F885Y probably damaging Het
Tgoln1 T C 6: 72,616,279 T73A probably benign Het
Tigd3 G A 19: 5,891,825 P426S probably benign Het
Tmem233 T A 5: 116,083,201 probably benign Het
Tnfrsf11a A G 1: 105,827,100 D299G possibly damaging Het
Trim32 T C 4: 65,613,455 V83A possibly damaging Het
Unc13a A T 8: 71,660,481 M242K probably benign Het
Vat1 C T 11: 101,462,215 G293D probably damaging Het
Vmn1r174 T A 7: 23,754,467 V186D possibly damaging Het
Wdfy3 A G 5: 101,948,898 Y345H probably damaging Het
Zzef1 C T 11: 72,875,177 T1510I probably benign Het
Other mutations in Spats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Spats2 APN 15 99180593 missense possibly damaging 0.88
IGL00696:Spats2 APN 15 99210894 missense probably damaging 1.00
IGL01524:Spats2 APN 15 99212246 missense probably benign 0.00
IGL02496:Spats2 APN 15 99173448 missense probably damaging 1.00
IGL03031:Spats2 APN 15 99180688 missense probably benign 0.00
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0630:Spats2 UTSW 15 99186028 splice site probably null
R1577:Spats2 UTSW 15 99178452 missense possibly damaging 0.94
R2012:Spats2 UTSW 15 99178494 missense probably damaging 0.97
R2229:Spats2 UTSW 15 99174453 critical splice donor site probably null
R2982:Spats2 UTSW 15 99211046 missense probably benign
R3743:Spats2 UTSW 15 99210914 missense probably benign 0.09
R4679:Spats2 UTSW 15 99180722 missense possibly damaging 0.62
R4857:Spats2 UTSW 15 99174420 missense probably damaging 1.00
R4962:Spats2 UTSW 15 99212276 missense probably benign 0.00
R5291:Spats2 UTSW 15 99178541 missense probably benign 0.16
R6879:Spats2 UTSW 15 99173412 missense probably damaging 1.00
R7187:Spats2 UTSW 15 99212173 missense probably benign 0.02
R7476:Spats2 UTSW 15 99212141 missense probably benign 0.00
R8084:Spats2 UTSW 15 99167080 missense possibly damaging 0.94
R8239:Spats2 UTSW 15 99208895 missense probably damaging 1.00
R8338:Spats2 UTSW 15 99178459 missense probably damaging 1.00
R9013:Spats2 UTSW 15 99199247 missense probably damaging 1.00
R9050:Spats2 UTSW 15 99212129 missense possibly damaging 0.78
R9433:Spats2 UTSW 15 99178565 nonsense probably null
X0062:Spats2 UTSW 15 99178532 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTATTTCCAGGCAACAGG -3'
(R):5'- TTTAGGATGGCCCAAAGAGATATG -3'

Sequencing Primer
(F):5'- GAGAGGAGGACAAGGCTACC -3'
(R):5'- CCTAAAGTCCAGTTATTAGGTTGAAC -3'
Posted On 2021-10-11