Incidental Mutation 'R8980:Krt76'
ID 683705
Institutional Source Beutler Lab
Gene Symbol Krt76
Ensembl Gene ENSMUSG00000075402
Gene Name keratin 76
Synonyms 2310001L23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8980 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101884351-101892920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101892555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000097754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100179]
AlphaFold Q3UV17
Predicted Effect unknown
Transcript: ENSMUST00000100179
AA Change: G102D
SMART Domains Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: G102D

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 161 5.7e-39 PFAM
Filament 164 479 2.12e-166 SMART
low complexity region 488 551 N/A INTRINSIC
low complexity region 565 593 N/A INTRINSIC
Meta Mutation Damage Score 0.1099 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 G A 8: 129,219,199 P382S probably damaging Het
Abcc1 G C 16: 14,461,097 M1090I probably damaging Het
Ak7 T A 12: 105,780,899 V675E probably benign Het
Ano10 T A 9: 122,261,492 I252L probably benign Het
Ano6 A G 15: 95,967,682 Y828C probably damaging Het
Aurkaip1 T G 4: 155,832,416 S40R probably damaging Het
Bcl2l11 T A 2: 128,158,280 I181N possibly damaging Het
Cdh23 T C 10: 60,337,846 Y1621C probably benign Het
Cep68 A T 11: 20,240,390 N207K probably benign Het
Clock T C 5: 76,254,439 I125V probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Eps15l1 A T 8: 72,373,890 H614Q probably benign Het
Gm29106 G A 1: 118,199,384 G269R possibly damaging Het
Gm3106 T C 5: 94,218,176 L51P probably damaging Het
Hexb A G 13: 97,194,181 V108A probably damaging Het
Ibtk G T 9: 85,732,730 C185* probably null Het
Josd2 A G 7: 44,468,278 probably benign Het
Nrap T A 19: 56,355,538 S645C probably damaging Het
Olfr834 A G 9: 18,988,127 I46M probably damaging Het
Prl2c5 T A 13: 13,185,885 F46I probably benign Het
Prss16 C T 13: 22,003,042 V453I probably benign Het
Psd A G 19: 46,322,218 L464P possibly damaging Het
Ptprb T C 10: 116,283,621 L220P probably benign Het
Rab7 A T 6: 88,000,520 V180E probably benign Het
Rc3h1 A G 1: 160,955,025 I691M probably benign Het
Rnf150 A G 8: 82,990,458 N198S probably benign Het
Sema4g A T 19: 44,993,144 M100L probably benign Het
Slc25a21 A G 12: 56,770,164 S106P probably benign Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
St8sia5 A G 18: 77,246,065 probably null Het
Themis3 A T 17: 66,555,541 I474N probably damaging Het
Uckl1 C A 2: 181,574,364 probably benign Het
Vmn1r177 A G 7: 23,865,719 V244A probably damaging Het
Vmn2r1 T A 3: 64,103,080 Y580N Het
Zfp11 T A 5: 129,660,779 M1L probably benign Het
Zfp462 TACCACCACCACCACCACCACCA TACCACCACCACCACCACCA 4: 55,009,681 probably benign Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp827 T C 8: 79,076,463 S555P probably benign Het
Other mutations in Krt76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Krt76 APN 15 101884888 missense unknown
IGL01475:Krt76 APN 15 101888513 missense probably benign 0.11
IGL01504:Krt76 APN 15 101888173 missense probably damaging 1.00
IGL01506:Krt76 APN 15 101892400 missense probably damaging 0.97
IGL01943:Krt76 APN 15 101889045 missense probably null 0.98
IGL03164:Krt76 APN 15 101887451 missense possibly damaging 0.50
PIT4378001:Krt76 UTSW 15 101892407 missense probably damaging 0.99
R0105:Krt76 UTSW 15 101884912 missense unknown
R0105:Krt76 UTSW 15 101884912 missense unknown
R0448:Krt76 UTSW 15 101890647 missense probably damaging 1.00
R0730:Krt76 UTSW 15 101887349 missense probably damaging 1.00
R0920:Krt76 UTSW 15 101892439 missense possibly damaging 0.80
R1568:Krt76 UTSW 15 101885008 missense unknown
R1779:Krt76 UTSW 15 101892687 missense unknown
R1869:Krt76 UTSW 15 101889487 critical splice donor site probably null
R1911:Krt76 UTSW 15 101888165 nonsense probably null
R2160:Krt76 UTSW 15 101888385 missense probably damaging 1.00
R2504:Krt76 UTSW 15 101884858 missense unknown
R4487:Krt76 UTSW 15 101890482 missense possibly damaging 0.71
R4729:Krt76 UTSW 15 101889081 missense probably damaging 1.00
R4747:Krt76 UTSW 15 101885745 missense probably damaging 1.00
R4912:Krt76 UTSW 15 101888162 nonsense probably null
R5357:Krt76 UTSW 15 101887385 missense probably benign 0.04
R6738:Krt76 UTSW 15 101887478 missense probably benign 0.40
R7786:Krt76 UTSW 15 101890530 missense probably damaging 0.98
R7808:Krt76 UTSW 15 101890494 missense probably damaging 1.00
R7825:Krt76 UTSW 15 101887503 missense possibly damaging 0.46
R8079:Krt76 UTSW 15 101888390 missense possibly damaging 0.61
R8846:Krt76 UTSW 15 101887337 missense probably damaging 1.00
Z1088:Krt76 UTSW 15 101890551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTGTTCACGCTCCTGG -3'
(R):5'- ACTCAGCTGTGGTATCTGGC -3'

Sequencing Primer
(F):5'- GCCTTCACTTGCCCAATCTGG -3'
(R):5'- TGGTATCTGGCAGCAGCAG -3'
Posted On 2021-10-11