Incidental Mutation 'R8981:Susd1'
ID 683723
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Name sushi domain containing 1
Synonyms Gm12528
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R8981 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 59314683-59438633 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59380883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000048201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
AlphaFold E9Q3H4
Predicted Effect probably benign
Transcript: ENSMUST00000040166
AA Change: V326A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: V326A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107544
AA Change: V273A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: V273A

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,326,499 V348I probably benign Het
Adam34 T A 8: 43,650,803 I602L probably benign Het
Adarb2 C T 13: 8,701,617 R473C probably damaging Het
AI314180 T A 4: 58,801,796 T1774S probably benign Het
AI464131 T C 4: 41,498,209 S474G possibly damaging Het
Arrdc3 A G 13: 80,890,550 I210M probably damaging Het
C1qb T C 4: 136,880,722 D110G probably benign Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,948,798 probably benign Het
Ces1d A G 8: 93,192,829 F112L probably benign Het
Cyp2j13 T A 4: 96,077,290 D60V possibly damaging Het
Dcun1d5 T A 9: 7,189,205 M98K probably damaging Het
Exosc7 T C 9: 123,113,300 V12A probably benign Het
Fam205a1 T C 4: 42,849,354 H934R probably benign Het
Fcrls T C 3: 87,257,370 Y283C probably damaging Het
Fgd6 A G 10: 94,045,054 D590G possibly damaging Het
Gne T C 4: 44,042,261 N469S probably benign Het
Ipo11 A T 13: 106,925,125 V9E probably benign Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Mcoln3 A G 3: 146,121,799 N3D probably benign Het
Mprip A G 11: 59,731,557 K157E probably damaging Het
Mthfr A T 4: 148,054,994 I588F probably benign Het
Mup15 A T 4: 61,439,588 C15* probably null Het
Myom1 A G 17: 71,084,321 T942A probably benign Het
Olfr1117-ps1 T C 2: 87,285,217 M309T probably benign Het
Olfr1532-ps1 T C 7: 106,914,383 F62L probably benign Het
Phf11c G A 14: 59,390,963 S79L possibly damaging Het
Pogz T A 3: 94,878,915 V938D probably damaging Het
Ppip5k1 C T 2: 121,327,640 probably benign Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Ric3 T C 7: 109,057,836 I100V probably damaging Het
Rptor T G 11: 119,843,682 S504A possibly damaging Het
Slc40a1 T C 1: 45,909,420 T567A probably benign Het
Slfn14 A T 11: 83,283,629 F179I possibly damaging Het
Thsd7b T C 1: 129,595,450 W74R possibly damaging Het
Ugt3a1 T G 15: 9,311,928 S419A probably benign Het
Vac14 A G 8: 110,711,594 E613G probably damaging Het
Vmn1r220 C A 13: 23,184,253 R91L probably damaging Het
Vrk1 C T 12: 106,070,694 probably benign Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R1998:Susd1 UTSW 4 59349925 missense probably benign 0.03
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R6081:Susd1 UTSW 4 59411359 missense possibly damaging 0.86
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7161:Susd1 UTSW 4 59329581 missense possibly damaging 0.85
R7172:Susd1 UTSW 4 59315420 splice site probably null
R7891:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
R8103:Susd1 UTSW 4 59365916 critical splice acceptor site probably null
R8299:Susd1 UTSW 4 59315773 missense probably benign 0.33
R8472:Susd1 UTSW 4 59332985 missense possibly damaging 0.96
R8831:Susd1 UTSW 4 59379594 splice site probably benign
R8903:Susd1 UTSW 4 59390576 missense probably benign 0.02
R9002:Susd1 UTSW 4 59324882 missense probably benign 0.00
R9091:Susd1 UTSW 4 59412226 missense probably benign 0.44
R9270:Susd1 UTSW 4 59412226 missense probably benign 0.44
R9296:Susd1 UTSW 4 59427865 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGCTGTTTCATGAGTTACACTATCTG -3'
(R):5'- ATTCAGCATCCGAACCAGCG -3'

Sequencing Primer
(F):5'- CATGAGTTACACTATCTGTAGCTTG -3'
(R):5'- CTGGTGAGCAGCCGAGATAC -3'
Posted On 2021-10-11