Incidental Mutation 'R8981:Ugt3a1'
ID683747
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8981 (G1)
Quality Score107.008
Status Not validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 9311928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 419 (S419A)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: S419A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: S419A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,326,499 V348I probably benign Het
Adam34 T A 8: 43,650,803 I602L probably benign Het
Adarb2 C T 13: 8,701,617 R473C probably damaging Het
AI314180 T A 4: 58,801,796 T1774S probably benign Het
AI464131 T C 4: 41,498,209 S474G possibly damaging Het
Arrdc3 A G 13: 80,890,550 I210M probably damaging Het
C1qb T C 4: 136,880,722 D110G probably benign Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,948,798 probably benign Het
Ces1d A G 8: 93,192,829 F112L probably benign Het
Cyp2j13 T A 4: 96,077,290 D60V possibly damaging Het
Dcun1d5 T A 9: 7,189,205 M98K probably damaging Het
Exosc7 T C 9: 123,113,300 V12A probably benign Het
Fam205a1 T C 4: 42,849,354 H934R probably benign Het
Fcrls T C 3: 87,257,370 Y283C probably damaging Het
Fgd6 A G 10: 94,045,054 D590G possibly damaging Het
Gne T C 4: 44,042,261 N469S probably benign Het
Ipo11 A T 13: 106,925,125 V9E probably benign Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Mcoln3 A G 3: 146,121,799 N3D probably benign Het
Mprip A G 11: 59,731,557 K157E probably damaging Het
Mthfr A T 4: 148,054,994 I588F probably benign Het
Mup15 A T 4: 61,439,588 C15* probably null Het
Myom1 A G 17: 71,084,321 T942A probably benign Het
Olfr1117-ps1 T C 2: 87,285,217 M309T probably benign Het
Olfr1532-ps1 T C 7: 106,914,383 F62L probably benign Het
Phf11c G A 14: 59,390,963 S79L possibly damaging Het
Pogz T A 3: 94,878,915 V938D probably damaging Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Ric3 T C 7: 109,057,836 I100V probably damaging Het
Rptor T G 11: 119,843,682 S504A possibly damaging Het
Slc40a1 T C 1: 45,909,420 T567A probably benign Het
Slfn14 A T 11: 83,283,629 F179I possibly damaging Het
Susd1 A G 4: 59,380,883 V326A probably benign Het
Thsd7b T C 1: 129,595,450 W74R possibly damaging Het
Vac14 A G 8: 110,711,594 E613G probably damaging Het
Vmn1r220 C A 13: 23,184,253 R91L probably damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8414:Ugt3a1 UTSW 15 9310583 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTGCAACAGCTCACCCTAGC -3'
(R):5'- CAGCACCACACTTAAAATTGGG -3'

Sequencing Primer
(F):5'- CAGCTCACCCTAGCATTCG -3'
(R):5'- CCACACTTAAAATTGGGATTAATAGC -3'
Posted On2021-10-11