Incidental Mutation 'R8981:Myom1'
ID 683748
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission 068814-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8981 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71326455-71433851 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71391316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 942 (T942A)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
AA Change: T844A

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: T844A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: T942A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: T942A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: T844A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: T844A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 44,103,840 (GRCm39) I602L probably benign Het
Adarb2 C T 13: 8,751,653 (GRCm39) R473C probably damaging Het
Arrdc3 A G 13: 81,038,669 (GRCm39) I210M probably damaging Het
C1qb T C 4: 136,608,033 (GRCm39) D110G probably benign Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,926,162 (GRCm39) probably benign Het
Ces1d A G 8: 93,919,457 (GRCm39) F112L probably benign Het
Cyp2j13 T A 4: 95,965,527 (GRCm39) D60V possibly damaging Het
Dcun1d5 T A 9: 7,189,205 (GRCm39) M98K probably damaging Het
Ecpas T A 4: 58,801,796 (GRCm39) T1774S probably benign Het
Exosc7 T C 9: 122,942,365 (GRCm39) V12A probably benign Het
Fcrl2 T C 3: 87,164,677 (GRCm39) Y283C probably damaging Het
Fgd6 A G 10: 93,880,916 (GRCm39) D590G possibly damaging Het
Gne T C 4: 44,042,261 (GRCm39) N469S probably benign Het
Ipo11 A T 13: 107,061,633 (GRCm39) V9E probably benign Het
Mad1l1 T C 5: 140,300,813 (GRCm39) T28A probably benign Het
Mcoln3 A G 3: 145,827,554 (GRCm39) N3D probably benign Het
Mprip A G 11: 59,622,383 (GRCm39) K157E probably damaging Het
Mthfr A T 4: 148,139,451 (GRCm39) I588F probably benign Het
Mup15 A T 4: 61,357,825 (GRCm39) C15* probably null Het
Myorg T C 4: 41,498,209 (GRCm39) S474G possibly damaging Het
Or10ag55-ps1 T C 2: 87,115,561 (GRCm39) M309T probably benign Het
Or2d3b T C 7: 106,513,590 (GRCm39) F62L probably benign Het
Phf11c G A 14: 59,628,412 (GRCm39) S79L possibly damaging Het
Pogz T A 3: 94,786,226 (GRCm39) V938D probably damaging Het
Ppip5k1 C T 2: 121,158,121 (GRCm39) probably benign Het
Pramel11 T A 4: 143,623,646 (GRCm39) N176I probably benign Het
Resf1 G A 6: 149,227,997 (GRCm39) V348I probably benign Het
Ric3 T C 7: 108,657,043 (GRCm39) I100V probably damaging Het
Rptor T G 11: 119,734,508 (GRCm39) S504A possibly damaging Het
Slc40a1 T C 1: 45,948,580 (GRCm39) T567A probably benign Het
Slfn14 A T 11: 83,174,455 (GRCm39) F179I possibly damaging Het
Spata31f1a T C 4: 42,849,354 (GRCm39) H934R probably benign Het
Susd1 A G 4: 59,380,883 (GRCm39) V326A probably benign Het
Thsd7b T C 1: 129,523,187 (GRCm39) W74R possibly damaging Het
Ugt3a1 T G 15: 9,312,014 (GRCm39) S419A probably benign Het
Vac14 A G 8: 111,438,226 (GRCm39) E613G probably damaging Het
Vmn1r220 C A 13: 23,368,423 (GRCm39) R91L probably damaging Het
Vrk1 C T 12: 106,036,953 (GRCm39) probably benign Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,433,093 (GRCm39) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,391,424 (GRCm39) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,406,944 (GRCm39) splice site probably benign
IGL00928:Myom1 APN 17 71,396,908 (GRCm39) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,384,912 (GRCm39) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,408,215 (GRCm39) splice site probably benign
IGL01588:Myom1 APN 17 71,424,432 (GRCm39) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,433,173 (GRCm39) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,406,988 (GRCm39) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,351,471 (GRCm39) splice site probably benign
IGL01766:Myom1 APN 17 71,384,283 (GRCm39) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,354,711 (GRCm39) splice site probably benign
IGL02122:Myom1 APN 17 71,399,132 (GRCm39) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,379,132 (GRCm39) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,415,310 (GRCm39) nonsense probably null
IGL02486:Myom1 APN 17 71,406,939 (GRCm39) splice site probably benign
IGL02501:Myom1 APN 17 71,379,076 (GRCm39) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,408,093 (GRCm39) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,391,344 (GRCm39) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,413,349 (GRCm39) splice site probably benign
IGL02945:Myom1 APN 17 71,399,088 (GRCm39) splice site probably benign
IGL03086:Myom1 APN 17 71,415,666 (GRCm39) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,391,311 (GRCm39) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,384,360 (GRCm39) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,352,750 (GRCm39) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,354,782 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,352,744 (GRCm39) missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71,341,688 (GRCm39) missense probably damaging 1.00
R0496:Myom1 UTSW 17 71,391,301 (GRCm39) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,399,215 (GRCm39) splice site probably benign
R0511:Myom1 UTSW 17 71,391,312 (GRCm39) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,427,643 (GRCm39) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,374,308 (GRCm39) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,384,762 (GRCm39) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,359,714 (GRCm39) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,408,024 (GRCm39) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,371,592 (GRCm39) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,330,189 (GRCm39) missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71,341,574 (GRCm39) missense probably damaging 0.98
R2442:Myom1 UTSW 17 71,417,730 (GRCm39) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,384,807 (GRCm39) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,341,648 (GRCm39) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,408,215 (GRCm39) splice site probably benign
R3440:Myom1 UTSW 17 71,352,658 (GRCm39) splice site probably null
R3842:Myom1 UTSW 17 71,352,619 (GRCm39) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,399,135 (GRCm39) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,343,348 (GRCm39) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,407,069 (GRCm39) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,384,405 (GRCm39) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,406,967 (GRCm39) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,416,782 (GRCm39) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,417,717 (GRCm39) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,424,438 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,415,690 (GRCm39) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,433,132 (GRCm39) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,329,887 (GRCm39) nonsense probably null
R6313:Myom1 UTSW 17 71,389,483 (GRCm39) missense probably benign
R6369:Myom1 UTSW 17 71,408,071 (GRCm39) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,389,300 (GRCm39) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,407,393 (GRCm39) splice site probably null
R6933:Myom1 UTSW 17 71,359,666 (GRCm39) missense probably damaging 1.00
R7168:Myom1 UTSW 17 71,396,942 (GRCm39) missense probably benign 0.00
R7286:Myom1 UTSW 17 71,352,544 (GRCm39) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,387,892 (GRCm39) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,391,235 (GRCm39) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,424,431 (GRCm39) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,352,747 (GRCm39) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,407,057 (GRCm39) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,391,290 (GRCm39) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,343,448 (GRCm39) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,413,199 (GRCm39) missense probably damaging 1.00
R9012:Myom1 UTSW 17 71,407,103 (GRCm39) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,343,295 (GRCm39) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,408,051 (GRCm39) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,384,888 (GRCm39) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,343,288 (GRCm39) missense probably benign 0.00
R9440:Myom1 UTSW 17 71,433,329 (GRCm39) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,368,122 (GRCm39) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,394,476 (GRCm39) missense probably damaging 1.00
R9612:Myom1 UTSW 17 71,412,475 (GRCm39) nonsense probably null
R9645:Myom1 UTSW 17 71,399,204 (GRCm39) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,407,066 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGTCTAGCAACCTCTTCCATGG -3'
(R):5'- AGCATACACGTGTGACATTATTGC -3'

Sequencing Primer
(F):5'- AACCTCTTCCATGGTGCCAGG -3'
(R):5'- GCAACCGTAACTTTGTAGGC -3'
Posted On 2021-10-11