Incidental Mutation 'R8982:Dnah7a'
ID 683750
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7a, Dnahc7, LOC381341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R8982 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53397006-53706784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53531142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1835 (E1835G)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: E1835G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: E1835G

low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,699,768 N493S probably benign Het
Actg2 T C 6: 83,520,715 D185G probably benign Het
Alpk3 A G 7: 81,099,002 N1439S probably damaging Het
Arid1b T A 17: 5,243,041 S745T probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
BC030867 G A 11: 102,255,284 A129T probably benign Het
C4b A G 17: 34,734,364 probably null Het
Cenpc1 A G 5: 86,047,674 S79P probably damaging Het
Cep295nl A T 11: 118,333,845 W58R probably damaging Het
Ces2f T A 8: 104,953,035 C387S probably benign Het
Cfap74 G A 4: 155,436,730 E620K Het
Ckap5 T C 2: 91,607,578 V1668A possibly damaging Het
Clock A G 5: 76,216,712 V852A unknown Het
Col22a1 A G 15: 71,973,638 probably null Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dnah3 T C 7: 119,937,071 Y684C probably damaging Het
F830045P16Rik T A 2: 129,472,892 Q155L probably damaging Het
Fhad1 T C 4: 142,002,584 D36G probably damaging Het
Gm13089 T G 4: 143,698,316 I186L probably benign Het
Hectd4 T C 5: 121,328,242 V2412A probably benign Het
Hoxa13 T A 6: 52,258,936 K210* probably null Het
Hoxc5 T C 15: 103,015,308 Y179H probably damaging Het
Htr1d A T 4: 136,443,555 Q365L possibly damaging Het
Krt72 C T 15: 101,781,624 V253M possibly damaging Het
Mecom G A 3: 29,963,106 T470I probably damaging Het
Nefh G A 11: 4,947,549 A129V probably damaging Het
Nlrp2 T A 7: 5,324,979 I692F probably damaging Het
Nr6a1 T A 2: 38,872,601 I61L probably benign Het
Olfr418 G A 1: 173,270,739 C188Y probably damaging Het
Olfr433 T G 1: 174,042,622 V224G probably damaging Het
Olfr73 A T 2: 88,034,269 I290K probably damaging Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pkhd1l1 T A 15: 44,523,673 L1314* probably null Het
Pogz G A 3: 94,879,568 V1156M probably damaging Het
Prrc2b T A 2: 32,212,122 C736S probably damaging Het
Psg18 T A 7: 18,349,375 H285L probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Rfx6 G A 10: 51,723,819 V554M probably benign Het
Rimbp3 A G 16: 17,209,647 T312A probably benign Het
Slfn5 G A 11: 82,960,140 W421* probably null Het
Srcin1 A G 11: 97,535,798 I291T probably damaging Het
Sult3a2 T C 10: 33,782,073 N15D probably damaging Het
Tmem179 A T 12: 112,501,867 L193Q probably damaging Het
Tmem200b T A 4: 131,922,357 L196Q probably damaging Het
Trim71 T C 9: 114,513,736 T493A possibly damaging Het
Trp53bp2 T A 1: 182,435,436 probably null Het
Zbtb7c G A 18: 76,146,273 G601S probably damaging Het
Zdhhc3 A G 9: 123,100,513 L19P probably benign Het
Zfp385b G T 2: 77,411,956 T473K probably damaging Het
Zfp651 A G 9: 121,763,268 E218G probably benign Het
Zfp804a A G 2: 82,235,828 K48E probably damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 splice site probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 splice site probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
R7813:Dnah7a UTSW 1 53618086 missense probably benign
R7839:Dnah7a UTSW 1 53567175 missense probably benign 0.08
R7959:Dnah7a UTSW 1 53643462 missense probably benign 0.00
R7984:Dnah7a UTSW 1 53504218 missense probably benign 0.01
R7985:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53503890 missense probably benign
R8140:Dnah7a UTSW 1 53501589 missense probably benign 0.02
R8184:Dnah7a UTSW 1 53627035 missense probably benign 0.03
R8339:Dnah7a UTSW 1 53685019 missense probably benign
R8352:Dnah7a UTSW 1 53427827 missense probably null 0.01
R8423:Dnah7a UTSW 1 53472904 missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53472953 missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53618036 missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53427827 missense probably null 0.01
R8458:Dnah7a UTSW 1 53617983 missense probably benign 0.01
R8493:Dnah7a UTSW 1 53472908 missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53617980 missense probably benign 0.01
R8502:Dnah7a UTSW 1 53640361 missense probably benign 0.39
R8692:Dnah7a UTSW 1 53433016 missense probably benign 0.00
R8700:Dnah7a UTSW 1 53495929 missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53635317 missense probably benign
R8856:Dnah7a UTSW 1 53423263 missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53643523 missense probably benign 0.10
R8967:Dnah7a UTSW 1 53643435 splice site probably benign
R8984:Dnah7a UTSW 1 53635277 nonsense probably null
R8993:Dnah7a UTSW 1 53504103 missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53662342 missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53472957 critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53521138 missense probably benign 0.00
R9077:Dnah7a UTSW 1 53702059 missense unknown
R9167:Dnah7a UTSW 1 53618211 missense probably benign 0.00
R9206:Dnah7a UTSW 1 53501598 missense probably benign 0.11
R9226:Dnah7a UTSW 1 53521167 missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53582512 missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53635346 missense probably benign
R9350:Dnah7a UTSW 1 53397148 missense probably benign 0.19
R9369:Dnah7a UTSW 1 53504262 missense probably benign
R9369:Dnah7a UTSW 1 53525063 missense possibly damaging 0.72
R9372:Dnah7a UTSW 1 53504315 missense probably benign
R9376:Dnah7a UTSW 1 53528899 critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53582617 missense probably benign 0.32
R9401:Dnah7a UTSW 1 53528867 missense probably benign 0.01
R9431:Dnah7a UTSW 1 53411653 missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53522336 missense probably damaging 1.00
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53483463 missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53411656 missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53559102 missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53643457 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-10-11