Incidental Mutation 'R8982:Alpk3'
ID 683777
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R8982 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81057600-81105612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81099002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1439 (N1439S)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: N1439S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: N1439S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,699,768 N493S probably benign Het
Actg2 T C 6: 83,520,715 D185G probably benign Het
Arid1b T A 17: 5,243,041 S745T probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
BC030867 G A 11: 102,255,284 A129T probably benign Het
C4b A G 17: 34,734,364 probably null Het
Cenpc1 A G 5: 86,047,674 S79P probably damaging Het
Cep295nl A T 11: 118,333,845 W58R probably damaging Het
Ces2f T A 8: 104,953,035 C387S probably benign Het
Cfap74 G A 4: 155,436,730 E620K Het
Ckap5 T C 2: 91,607,578 V1668A possibly damaging Het
Clock A G 5: 76,216,712 V852A unknown Het
Col22a1 A G 15: 71,973,638 probably null Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dnah3 T C 7: 119,937,071 Y684C probably damaging Het
Dnah7a T C 1: 53,531,142 E1835G probably benign Het
F830045P16Rik T A 2: 129,472,892 Q155L probably damaging Het
Fhad1 T C 4: 142,002,584 D36G probably damaging Het
Gm13089 T G 4: 143,698,316 I186L probably benign Het
Hectd4 T C 5: 121,328,242 V2412A probably benign Het
Hoxa13 T A 6: 52,258,936 K210* probably null Het
Hoxc5 T C 15: 103,015,308 Y179H probably damaging Het
Htr1d A T 4: 136,443,555 Q365L possibly damaging Het
Krt72 C T 15: 101,781,624 V253M possibly damaging Het
Mecom G A 3: 29,963,106 T470I probably damaging Het
Nefh G A 11: 4,947,549 A129V probably damaging Het
Nlrp2 T A 7: 5,324,979 I692F probably damaging Het
Nr6a1 T A 2: 38,872,601 I61L probably benign Het
Olfr418 G A 1: 173,270,739 C188Y probably damaging Het
Olfr433 T G 1: 174,042,622 V224G probably damaging Het
Olfr73 A T 2: 88,034,269 I290K probably damaging Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pkhd1l1 T A 15: 44,523,673 L1314* probably null Het
Pogz G A 3: 94,879,568 V1156M probably damaging Het
Prrc2b T A 2: 32,212,122 C736S probably damaging Het
Psg18 T A 7: 18,349,375 H285L probably benign Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Rfx6 G A 10: 51,723,819 V554M probably benign Het
Rimbp3 A G 16: 17,209,647 T312A probably benign Het
Slfn5 G A 11: 82,960,140 W421* probably null Het
Srcin1 A G 11: 97,535,798 I291T probably damaging Het
Sult3a2 T C 10: 33,782,073 N15D probably damaging Het
Tmem179 A T 12: 112,501,867 L193Q probably damaging Het
Tmem200b T A 4: 131,922,357 L196Q probably damaging Het
Trim71 T C 9: 114,513,736 T493A possibly damaging Het
Trp53bp2 T A 1: 182,435,436 probably null Het
Zbtb7c G A 18: 76,146,273 G601S probably damaging Het
Zdhhc3 A G 9: 123,100,513 L19P probably benign Het
Zfp385b G T 2: 77,411,956 T473K probably damaging Het
Zfp651 A G 9: 121,763,268 E218G probably benign Het
Zfp804a A G 2: 82,235,828 K48E probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8794:Alpk3 UTSW 7 81057655 missense unknown
R9259:Alpk3 UTSW 7 81093554 missense probably damaging 1.00
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTAAGGGTCTGGCTGAC -3'
(R):5'- TGGGTTCACAGCTGTACCTC -3'

Sequencing Primer
(F):5'- ACAAGCTCTTTGGGCGATTG -3'
(R):5'- GTACCTCAGCCAGTCCTTGAAG -3'
Posted On 2021-10-11