Mutagenetix > Incidental Mutation

Incidental Mutation 'R8982:Alpk3'

683777

Institutional Source

Beutler Lab

Gene Symbol

Alpk3

Ensembl Gene

ENSMUSG00000038763

Gene Name

alpha-kinase 3

Synonyms

Midori

MMRRC Submission

068815-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R8982 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81057600-81105612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81099002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1439 (N1439S)

Ref Sequence

ENSEMBL: ENSMUSP00000102971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107348]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107348
AA Change: N1439S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: N1439S

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
IGc2	89	159	2.78e-11	SMART
low complexity region	183	192	N/A	INTRINSIC
low complexity region	400	427	N/A	INTRINSIC
low complexity region	514	532	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	958	971	N/A	INTRINSIC
low complexity region	1048	1058	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC
IG_like	1264	1330	5.73e-2	SMART
low complexity region	1350	1359	N/A	INTRINSIC
Alpha_kinase	1395	1592	1.17e-44	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,699,768	N493S	probably benign	Het
Actg2	T	C	6: 83,520,715	D185G	probably benign	Het
Arid1b	T	A	17: 5,243,041	S745T	probably damaging	Het
Atxn2l	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	7: 126,494,248		probably benign	Het
BC030867	G	A	11: 102,255,284	A129T	probably benign	Het
C4b	A	G	17: 34,734,364		probably null	Het
Cenpc1	A	G	5: 86,047,674	S79P	probably damaging	Het
Cep295nl	A	T	11: 118,333,845	W58R	probably damaging	Het
Ces2f	T	A	8: 104,953,035	C387S	probably benign	Het
Cfap74	G	A	4: 155,436,730	E620K		Het
Ckap5	T	C	2: 91,607,578	V1668A	possibly damaging	Het
Clock	A	G	5: 76,216,712	V852A	unknown	Het
Col22a1	A	G	15: 71,973,638		probably null	Het
Copb2	T	C	9: 98,574,111	S233P	probably damaging	Het
Dnah3	T	C	7: 119,937,071	Y684C	probably damaging	Het
Dnah7a	T	C	1: 53,531,142	E1835G	probably benign	Het
F830045P16Rik	T	A	2: 129,472,892	Q155L	probably damaging	Het
Fhad1	T	C	4: 142,002,584	D36G	probably damaging	Het
Gm13089	T	G	4: 143,698,316	I186L	probably benign	Het
Hectd4	T	C	5: 121,328,242	V2412A	probably benign	Het
Hoxa13	T	A	6: 52,258,936	K210*	probably null	Het
Hoxc5	T	C	15: 103,015,308	Y179H	probably damaging	Het
Htr1d	A	T	4: 136,443,555	Q365L	possibly damaging	Het
Krt72	C	T	15: 101,781,624	V253M	possibly damaging	Het
Mecom	G	A	3: 29,963,106	T470I	probably damaging	Het
Nefh	G	A	11: 4,947,549	A129V	probably damaging	Het
Nlrp2	T	A	7: 5,324,979	I692F	probably damaging	Het
Nr6a1	T	A	2: 38,872,601	I61L	probably benign	Het
Olfr418	G	A	1: 173,270,739	C188Y	probably damaging	Het
Olfr433	T	G	1: 174,042,622	V224G	probably damaging	Het
Olfr73	A	T	2: 88,034,269	I290K	probably damaging	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pkhd1l1	T	A	15: 44,523,673	L1314*	probably null	Het
Pogz	G	A	3: 94,879,568	V1156M	probably damaging	Het
Prrc2b	T	A	2: 32,212,122	C736S	probably damaging	Het
Psg18	T	A	7: 18,349,375	H285L	probably benign	Het
Ptprb	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,677		probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Rfx6	G	A	10: 51,723,819	V554M	probably benign	Het
Rimbp3	A	G	16: 17,209,647	T312A	probably benign	Het
Slfn5	G	A	11: 82,960,140	W421*	probably null	Het
Srcin1	A	G	11: 97,535,798	I291T	probably damaging	Het
Sult3a2	T	C	10: 33,782,073	N15D	probably damaging	Het
Tmem179	A	T	12: 112,501,867	L193Q	probably damaging	Het
Tmem200b	T	A	4: 131,922,357	L196Q	probably damaging	Het
Trim71	T	C	9: 114,513,736	T493A	possibly damaging	Het
Trp53bp2	T	A	1: 182,435,436		probably null	Het
Zbtb7c	G	A	18: 76,146,273	G601S	probably damaging	Het
Zdhhc3	A	G	9: 123,100,513	L19P	probably benign	Het
Zfp385b	G	T	2: 77,411,956	T473K	probably damaging	Het
Zfp651	A	G	9: 121,763,268	E218G	probably benign	Het
Zfp804a	A	G	2: 82,235,828	K48E	probably damaging	Het

Other mutations in Alpk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Alpk3	APN	7	81078009	missense	possibly damaging	0.95
IGL00472:Alpk3	APN	7	81095653	splice site	probably benign
IGL01732:Alpk3	APN	7	81057642	missense	unknown
IGL01750:Alpk3	APN	7	81092282	missense	probably damaging	1.00
IGL01812:Alpk3	APN	7	81100202	missense	probably damaging	1.00
IGL02224:Alpk3	APN	7	81076868	splice site	probably benign
IGL02292:Alpk3	APN	7	81077905	missense	possibly damaging	0.46
IGL02340:Alpk3	APN	7	81078507	missense	probably benign	0.03
IGL02517:Alpk3	APN	7	81077895	missense	probably benign	0.00
IGL02725:Alpk3	APN	7	81093610	missense	possibly damaging	0.91
IGL02755:Alpk3	APN	7	81093759	missense	possibly damaging	0.71
IGL03035:Alpk3	APN	7	81078604	missense	probably benign	0.00
IGL03102:Alpk3	APN	7	81095056	critical splice donor site	probably null
IGL03153:Alpk3	APN	7	81093395	missense	probably benign	0.00
IGL03255:Alpk3	APN	7	81092562	missense	probably benign	0.01
IGL03367:Alpk3	APN	7	81094990	missense	probably benign	0.01
FR4304:Alpk3	UTSW	7	81077762	small insertion	probably benign
FR4737:Alpk3	UTSW	7	81077762	small insertion	probably benign
IGL03097:Alpk3	UTSW	7	81093909	missense	probably benign	0.00
R0092:Alpk3	UTSW	7	81092553	missense	probably benign
R0254:Alpk3	UTSW	7	81076974	missense	probably benign	0.43
R0310:Alpk3	UTSW	7	81078610	missense	possibly damaging	0.61
R0325:Alpk3	UTSW	7	81067953	missense	possibly damaging	0.58
R0387:Alpk3	UTSW	7	81104227	missense	possibly damaging	0.93
R0971:Alpk3	UTSW	7	81092579	missense	possibly damaging	0.55
R1078:Alpk3	UTSW	7	81078600	missense	probably benign
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1168:Alpk3	UTSW	7	81103357	missense	probably damaging	1.00
R1306:Alpk3	UTSW	7	81093873	missense	probably damaging	1.00
R1822:Alpk3	UTSW	7	81076931	nonsense	probably null
R2173:Alpk3	UTSW	7	81076900	missense	probably damaging	1.00
R2350:Alpk3	UTSW	7	81094970	missense	probably damaging	1.00
R2414:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2417:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2885:Alpk3	UTSW	7	81100192	missense	probably damaging	1.00
R3004:Alpk3	UTSW	7	81103355	nonsense	probably null
R3796:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3797:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3798:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3799:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3894:Alpk3	UTSW	7	81078390	missense	possibly damaging	0.93
R4395:Alpk3	UTSW	7	81094955	missense	probably damaging	1.00
R4761:Alpk3	UTSW	7	81104168	missense	probably damaging	0.99
R5505:Alpk3	UTSW	7	81078561	missense	possibly damaging	0.87
R5540:Alpk3	UTSW	7	81095436	missense	probably damaging	1.00
R5770:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R5941:Alpk3	UTSW	7	81078653	missense	probably damaging	1.00
R5964:Alpk3	UTSW	7	81092260	missense	possibly damaging	0.88
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6066:Alpk3	UTSW	7	81076950	missense	possibly damaging	0.89
R6517:Alpk3	UTSW	7	81078579	missense	possibly damaging	0.54
R6578:Alpk3	UTSW	7	81078684	missense	probably benign	0.00
R7230:Alpk3	UTSW	7	81093294	missense	probably damaging	1.00
R7266:Alpk3	UTSW	7	81092580	missense	possibly damaging	0.55
R7271:Alpk3	UTSW	7	81078454	missense	possibly damaging	0.92
R7402:Alpk3	UTSW	7	81076912	missense	probably benign	0.29
R7411:Alpk3	UTSW	7	81092852	missense	probably benign	0.11
R7454:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R7468:Alpk3	UTSW	7	81100998	nonsense	probably null
R7940:Alpk3	UTSW	7	81093945	missense	probably damaging	1.00
R8157:Alpk3	UTSW	7	81093722	missense	probably benign	0.00
R8246:Alpk3	UTSW	7	81092776	missense	probably benign	0.00
R8357:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8444:Alpk3	UTSW	7	81057720	missense	probably benign	0.08
R8457:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8775:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8775-TAIL:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8794:Alpk3	UTSW	7	81057655	missense	unknown
R9259:Alpk3	UTSW	7	81093554	missense	probably damaging	1.00
R9343:Alpk3	UTSW	7	81092331	missense	probably benign	0.27
R9567:Alpk3	UTSW	7	81092939	missense	possibly damaging	0.55
R9792:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9793:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9798:Alpk3	UTSW	7	81092652	missense	probably benign	0.02
RF034:Alpk3	UTSW	7	81092414	small deletion	probably benign
RF057:Alpk3	UTSW	7	81092417	frame shift	probably null
X0022:Alpk3	UTSW	7	81093897	missense	probably damaging	0.96
Z1176:Alpk3	UTSW	7	81078626	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCTAAGGGTCTGGCTGAC -3'
(R):5'- TGGGTTCACAGCTGTACCTC -3'

Sequencing Primer
(F):5'- ACAAGCTCTTTGGGCGATTG -3'
(R):5'- GTACCTCAGCCAGTCCTTGAAG -3'

Posted On

2021-10-11