Incidental Mutation 'R8982:Rimbp3'
ID 683799
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8982 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17209647 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 312 (T312A)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: T312A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: T312A

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,699,768 N493S probably benign Het
Actg2 T C 6: 83,520,715 D185G probably benign Het
Alpk3 A G 7: 81,099,002 N1439S probably damaging Het
Arid1b T A 17: 5,243,041 S745T probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
BC030867 G A 11: 102,255,284 A129T probably benign Het
C4b A G 17: 34,734,364 probably null Het
Cenpc1 A G 5: 86,047,674 S79P probably damaging Het
Cep295nl A T 11: 118,333,845 W58R probably damaging Het
Ces2f T A 8: 104,953,035 C387S probably benign Het
Cfap74 G A 4: 155,436,730 E620K Het
Ckap5 T C 2: 91,607,578 V1668A possibly damaging Het
Clock A G 5: 76,216,712 V852A unknown Het
Col22a1 A G 15: 71,973,638 probably null Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dnah3 T C 7: 119,937,071 Y684C probably damaging Het
Dnah7a T C 1: 53,531,142 E1835G probably benign Het
F830045P16Rik T A 2: 129,472,892 Q155L probably damaging Het
Fhad1 T C 4: 142,002,584 D36G probably damaging Het
Gm13089 T G 4: 143,698,316 I186L probably benign Het
Hectd4 T C 5: 121,328,242 V2412A probably benign Het
Hoxa13 T A 6: 52,258,936 K210* probably null Het
Hoxc5 T C 15: 103,015,308 Y179H probably damaging Het
Htr1d A T 4: 136,443,555 Q365L possibly damaging Het
Krt72 C T 15: 101,781,624 V253M possibly damaging Het
Mecom G A 3: 29,963,106 T470I probably damaging Het
Nefh G A 11: 4,947,549 A129V probably damaging Het
Nlrp2 T A 7: 5,324,979 I692F probably damaging Het
Nr6a1 T A 2: 38,872,601 I61L probably benign Het
Olfr418 G A 1: 173,270,739 C188Y probably damaging Het
Olfr433 T G 1: 174,042,622 V224G probably damaging Het
Olfr73 A T 2: 88,034,269 I290K probably damaging Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pkhd1l1 T A 15: 44,523,673 L1314* probably null Het
Pogz G A 3: 94,879,568 V1156M probably damaging Het
Prrc2b T A 2: 32,212,122 C736S probably damaging Het
Psg18 T A 7: 18,349,375 H285L probably benign Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Rfx6 G A 10: 51,723,819 V554M probably benign Het
Slfn5 G A 11: 82,960,140 W421* probably null Het
Srcin1 A G 11: 97,535,798 I291T probably damaging Het
Sult3a2 T C 10: 33,782,073 N15D probably damaging Het
Tmem179 A T 12: 112,501,867 L193Q probably damaging Het
Tmem200b T A 4: 131,922,357 L196Q probably damaging Het
Trim71 T C 9: 114,513,736 T493A possibly damaging Het
Trp53bp2 T A 1: 182,435,436 probably null Het
Zbtb7c G A 18: 76,146,273 G601S probably damaging Het
Zdhhc3 A G 9: 123,100,513 L19P probably benign Het
Zfp385b G T 2: 77,411,956 T473K probably damaging Het
Zfp651 A G 9: 121,763,268 E218G probably benign Het
Zfp804a A G 2: 82,235,828 K48E probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCGAAAGCCTGAACACTGG -3'
(R):5'- CGCAGATGCAAGTTTTCTTCGC -3'

Sequencing Primer
(F):5'- ACTGGCGTCCGGGTTCATTC -3'
(R):5'- TCTTCGCGCAGGTCACAAC -3'
Posted On 2021-10-11