Incidental Mutation 'R8982:C4b'
ID 683801
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement component 4B (Chido blood group)
Synonyms C4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8982 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34728380-34743882 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34734364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably null
Transcript: ENSMUST00000069507
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,699,768 N493S probably benign Het
Actg2 T C 6: 83,520,715 D185G probably benign Het
Alpk3 A G 7: 81,099,002 N1439S probably damaging Het
Arid1b T A 17: 5,243,041 S745T probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
BC030867 G A 11: 102,255,284 A129T probably benign Het
Cenpc1 A G 5: 86,047,674 S79P probably damaging Het
Cep295nl A T 11: 118,333,845 W58R probably damaging Het
Ces2f T A 8: 104,953,035 C387S probably benign Het
Cfap74 G A 4: 155,436,730 E620K Het
Ckap5 T C 2: 91,607,578 V1668A possibly damaging Het
Clock A G 5: 76,216,712 V852A unknown Het
Col22a1 A G 15: 71,973,638 probably null Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dnah3 T C 7: 119,937,071 Y684C probably damaging Het
Dnah7a T C 1: 53,531,142 E1835G probably benign Het
F830045P16Rik T A 2: 129,472,892 Q155L probably damaging Het
Fhad1 T C 4: 142,002,584 D36G probably damaging Het
Gm13089 T G 4: 143,698,316 I186L probably benign Het
Hectd4 T C 5: 121,328,242 V2412A probably benign Het
Hoxa13 T A 6: 52,258,936 K210* probably null Het
Hoxc5 T C 15: 103,015,308 Y179H probably damaging Het
Htr1d A T 4: 136,443,555 Q365L possibly damaging Het
Krt72 C T 15: 101,781,624 V253M possibly damaging Het
Mecom G A 3: 29,963,106 T470I probably damaging Het
Nefh G A 11: 4,947,549 A129V probably damaging Het
Nlrp2 T A 7: 5,324,979 I692F probably damaging Het
Nr6a1 T A 2: 38,872,601 I61L probably benign Het
Olfr418 G A 1: 173,270,739 C188Y probably damaging Het
Olfr433 T G 1: 174,042,622 V224G probably damaging Het
Olfr73 A T 2: 88,034,269 I290K probably damaging Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pkhd1l1 T A 15: 44,523,673 L1314* probably null Het
Pogz G A 3: 94,879,568 V1156M probably damaging Het
Prrc2b T A 2: 32,212,122 C736S probably damaging Het
Psg18 T A 7: 18,349,375 H285L probably benign Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Rfx6 G A 10: 51,723,819 V554M probably benign Het
Rimbp3 A G 16: 17,209,647 T312A probably benign Het
Slfn5 G A 11: 82,960,140 W421* probably null Het
Srcin1 A G 11: 97,535,798 I291T probably damaging Het
Sult3a2 T C 10: 33,782,073 N15D probably damaging Het
Tmem179 A T 12: 112,501,867 L193Q probably damaging Het
Tmem200b T A 4: 131,922,357 L196Q probably damaging Het
Trim71 T C 9: 114,513,736 T493A possibly damaging Het
Trp53bp2 T A 1: 182,435,436 probably null Het
Zbtb7c G A 18: 76,146,273 G601S probably damaging Het
Zdhhc3 A G 9: 123,100,513 L19P probably benign Het
Zfp385b G T 2: 77,411,956 T473K probably damaging Het
Zfp651 A G 9: 121,763,268 E218G probably benign Het
Zfp804a A G 2: 82,235,828 K48E probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
R8853:C4b UTSW 17 34729905 missense possibly damaging 0.91
R8934:C4b UTSW 17 34732984 missense possibly damaging 0.78
R8944:C4b UTSW 17 34742939 missense probably benign 0.00
R8960:C4b UTSW 17 34733918 missense probably damaging 1.00
R9104:C4b UTSW 17 34729259 missense probably benign 0.39
R9114:C4b UTSW 17 34729430 missense probably damaging 0.99
R9348:C4b UTSW 17 34733185 missense probably benign 0.01
R9428:C4b UTSW 17 34730911 missense possibly damaging 0.52
R9533:C4b UTSW 17 34737724 nonsense probably null
R9591:C4b UTSW 17 34738955 missense probably benign 0.00
R9678:C4b UTSW 17 34741789 critical splice donor site probably null
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTGCTGGATCCTCATGTATC -3'
(R):5'- TGTCCTTTAGCCTCGGAACC -3'

Sequencing Primer
(F):5'- CTGGATCCTCATGTATCCTGGG -3'
(R):5'- TCGGAACCCTTGGAGACTATG -3'
Posted On 2021-10-11