Incidental Mutation 'R8983:4930430A15Rik'
ID 683808
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8983 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111200356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 403 (S403P)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000142636]
AlphaFold Q05AC5
Predicted Effect probably benign
Transcript: ENSMUST00000028577
AA Change: S403P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: S403P

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142636
AA Change: S31P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117759
Gene: ENSMUSG00000027157
AA Change: S31P

DomainStartEndE-ValueType
internal_repeat_1 1 69 7.48e-6 PROSPERO
internal_repeat_1 81 153 7.48e-6 PROSPERO
low complexity region 168 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,000 S250P possibly damaging Het
4921509C19Rik A T 2: 151,471,352 F632I unknown Het
5730522E02Rik T C 11: 25,769,069 T26A unknown Het
Ablim1 A T 19: 57,239,212 V7E probably benign Het
Adcy5 T G 16: 35,156,862 L255R possibly damaging Het
Ahnak C A 19: 9,004,113 N920K possibly damaging Het
Arhgef11 A G 3: 87,733,201 K1251E Het
Astn1 T A 1: 158,664,130 probably null Het
Atxn2 A G 5: 121,778,000 Y423C probably damaging Het
Ccdc180 T A 4: 45,909,359 V509D possibly damaging Het
Ccdc80 T C 16: 45,104,417 V638A possibly damaging Het
Ccr6 T G 17: 8,256,046 C28G probably damaging Het
Cdca7l A G 12: 117,865,167 probably benign Het
Cnot3 T C 7: 3,651,329 I52T probably damaging Het
Cped1 A T 6: 22,138,687 N555I probably benign Het
Cpne6 A T 14: 55,516,254 I390F probably damaging Het
Dlec1 A G 9: 119,128,351 D836G probably benign Het
Dnah8 T A 17: 30,851,654 V4438D probably damaging Het
Dok3 G T 13: 55,523,722 N345K probably damaging Het
Eea1 C T 10: 96,019,879 Q593* probably null Het
Eif3m T C 2: 104,999,794 Y351C possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Epn3 T C 11: 94,496,088 E152G probably damaging Het
Faf2 A G 13: 54,621,913 S25G probably benign Het
Fam83b A G 9: 76,493,075 S249P probably damaging Het
Fgl1 A T 8: 41,200,459 S132R probably benign Het
Frem3 A G 8: 80,669,246 E1890G probably damaging Het
Gm960 T C 19: 4,645,686 I513V possibly damaging Het
Gpc5 T A 14: 115,092,686 S94T unknown Het
Hectd1 A G 12: 51,744,627 V2584A probably damaging Het
Kifc3 G A 8: 95,106,476 A498V probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Lor T C 3: 92,081,139 Y280C unknown Het
Lpin2 C T 17: 71,246,967 A931V unknown Het
Lpxn A G 19: 12,833,158 H322R probably damaging Het
Megf9 A G 4: 70,435,397 S391P probably benign Het
Mipep G A 14: 60,843,253 V565I probably benign Het
Mmrn1 C T 6: 60,976,058 T441I probably benign Het
Mpp5 G A 12: 78,837,524 D640N probably damaging Het
Mrpl48 T C 7: 100,574,495 N14S probably benign Het
Ncald A G 15: 37,397,268 F56S probably damaging Het
Olfr1012 T C 2: 85,753,907 probably benign Het
Plcd3 A G 11: 103,071,266 V703A possibly damaging Het
Qser1 T C 2: 104,787,357 I947V probably benign Het
Rdx G A 9: 52,063,605 A14T probably damaging Het
Rnf213 A G 11: 119,430,349 D1211G Het
Sbpl T C 17: 23,953,279 D222G unknown Het
Scn8a C A 15: 101,002,149 T703K possibly damaging Het
Setbp1 A G 18: 78,859,244 S403P probably benign Het
Sfmbt2 A G 2: 10,404,456 S71G probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,036 probably benign Het
Smco3 C T 6: 136,831,732 G48D possibly damaging Het
Spag9 T C 11: 94,067,989 S280P probably benign Het
Thada T C 17: 84,231,087 T1498A probably benign Het
Tmprss7 T C 16: 45,660,900 D641G probably damaging Het
Trim43a A G 9: 88,582,351 D105G probably benign Het
Utp14b T A 1: 78,665,286 N300K probably benign Het
Vmn2r83 T G 10: 79,491,526 I656S probably damaging Het
Zfp646 A T 7: 127,881,605 M985L probably benign Het
Zfp777 A T 6: 48,029,224 L412Q probably damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8679:4930430A15Rik UTSW 2 111229222 missense possibly damaging 0.73
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTTGTTAACAATTGCAGC -3'
(R):5'- CCTTGAACATGTTGCCATCTAC -3'

Sequencing Primer
(F):5'- CCTTGTTAACAATTGCAGCCATTTAG -3'
(R):5'- TCTTTAAGAGTATAAACAACCAGCTC -3'
Posted On 2021-10-11