Incidental Mutation 'R8983:Lor'
ID 683811
Institutional Source Beutler Lab
Gene Symbol Lor
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8983 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 92080271-92083142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92081139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 280 (Y280C)
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect unknown
Transcript: ENSMUST00000058150
AA Change: Y280C
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165
AA Change: Y280C

DomainStartEndE-ValueType
Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,000 S250P possibly damaging Het
4921509C19Rik A T 2: 151,471,352 F632I unknown Het
4930430A15Rik A G 2: 111,200,356 S403P probably benign Het
5730522E02Rik T C 11: 25,769,069 T26A unknown Het
Ablim1 A T 19: 57,239,212 V7E probably benign Het
Adcy5 T G 16: 35,156,862 L255R possibly damaging Het
Ahnak C A 19: 9,004,113 N920K possibly damaging Het
Arhgef11 A G 3: 87,733,201 K1251E Het
Astn1 T A 1: 158,664,130 probably null Het
Atxn2 A G 5: 121,778,000 Y423C probably damaging Het
Ccdc180 T A 4: 45,909,359 V509D possibly damaging Het
Ccdc80 T C 16: 45,104,417 V638A possibly damaging Het
Ccr6 T G 17: 8,256,046 C28G probably damaging Het
Cdca7l A G 12: 117,865,167 probably benign Het
Cnot3 T C 7: 3,651,329 I52T probably damaging Het
Cped1 A T 6: 22,138,687 N555I probably benign Het
Cpne6 A T 14: 55,516,254 I390F probably damaging Het
Dlec1 A G 9: 119,128,351 D836G probably benign Het
Dnah8 T A 17: 30,851,654 V4438D probably damaging Het
Dok3 G T 13: 55,523,722 N345K probably damaging Het
Eea1 C T 10: 96,019,879 Q593* probably null Het
Eif3m T C 2: 104,999,794 Y351C possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Epn3 T C 11: 94,496,088 E152G probably damaging Het
Faf2 A G 13: 54,621,913 S25G probably benign Het
Fam83b A G 9: 76,493,075 S249P probably damaging Het
Fgl1 A T 8: 41,200,459 S132R probably benign Het
Frem3 A G 8: 80,669,246 E1890G probably damaging Het
Gm960 T C 19: 4,645,686 I513V possibly damaging Het
Gpc5 T A 14: 115,092,686 S94T unknown Het
Hectd1 A G 12: 51,744,627 V2584A probably damaging Het
Kifc3 G A 8: 95,106,476 A498V probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Lpin2 C T 17: 71,246,967 A931V unknown Het
Lpxn A G 19: 12,833,158 H322R probably damaging Het
Megf9 A G 4: 70,435,397 S391P probably benign Het
Mipep G A 14: 60,843,253 V565I probably benign Het
Mmrn1 C T 6: 60,976,058 T441I probably benign Het
Mpp5 G A 12: 78,837,524 D640N probably damaging Het
Mrpl48 T C 7: 100,574,495 N14S probably benign Het
Ncald A G 15: 37,397,268 F56S probably damaging Het
Olfr1012 T C 2: 85,753,907 probably benign Het
Plcd3 A G 11: 103,071,266 V703A possibly damaging Het
Qser1 T C 2: 104,787,357 I947V probably benign Het
Rdx G A 9: 52,063,605 A14T probably damaging Het
Rnf213 A G 11: 119,430,349 D1211G Het
Sbpl T C 17: 23,953,279 D222G unknown Het
Scn8a C A 15: 101,002,149 T703K possibly damaging Het
Setbp1 A G 18: 78,859,244 S403P probably benign Het
Sfmbt2 A G 2: 10,404,456 S71G probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,036 probably benign Het
Smco3 C T 6: 136,831,732 G48D possibly damaging Het
Spag9 T C 11: 94,067,989 S280P probably benign Het
Thada T C 17: 84,231,087 T1498A probably benign Het
Tmprss7 T C 16: 45,660,900 D641G probably damaging Het
Trim43a A G 9: 88,582,351 D105G probably benign Het
Utp14b T A 1: 78,665,286 N300K probably benign Het
Vmn2r83 T G 10: 79,491,526 I656S probably damaging Het
Zfp646 A T 7: 127,881,605 M985L probably benign Het
Zfp777 A T 6: 48,029,224 L412Q probably damaging Het
Other mutations in Lor
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Lor UTSW 3 92081894 frame shift probably null
R2932:Lor UTSW 3 92081878 small deletion probably benign
R4677:Lor UTSW 3 92081743 missense unknown
R5454:Lor UTSW 3 92081482 missense unknown
R5851:Lor UTSW 3 92080539 missense unknown
R6267:Lor UTSW 3 92081812 nonsense probably null
R7219:Lor UTSW 3 92081398 missense unknown
R7430:Lor UTSW 3 92081899 missense unknown
R7780:Lor UTSW 3 92081153 nonsense probably null
RF027:Lor UTSW 3 92081876 small deletion probably benign
RF028:Lor UTSW 3 92081899 frame shift probably null
RF031:Lor UTSW 3 92081876 small deletion probably benign
X0057:Lor UTSW 3 92081878 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTGAGAGGAGTAATAGCC -3'
(R):5'- AGGCGGCAAGTACTCTGGT -3'

Sequencing Primer
(F):5'- TGAGAGGAGTAATAGCCCCCTC -3'
(R):5'- AAGTACTCTGGTGGCGGC -3'
Posted On 2021-10-11