Incidental Mutation 'R8983:Rdx'
ID 683829
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8983 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 52047173-52088735 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52063605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 14 (A14T)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: A14T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: A14T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: A14T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,000 S250P possibly damaging Het
4921509C19Rik A T 2: 151,471,352 F632I unknown Het
4930430A15Rik A G 2: 111,200,356 S403P probably benign Het
5730522E02Rik T C 11: 25,769,069 T26A unknown Het
Ablim1 A T 19: 57,239,212 V7E probably benign Het
Adcy5 T G 16: 35,156,862 L255R possibly damaging Het
Ahnak C A 19: 9,004,113 N920K possibly damaging Het
Arhgef11 A G 3: 87,733,201 K1251E Het
Astn1 T A 1: 158,664,130 probably null Het
Atxn2 A G 5: 121,778,000 Y423C probably damaging Het
Ccdc180 T A 4: 45,909,359 V509D possibly damaging Het
Ccdc80 T C 16: 45,104,417 V638A possibly damaging Het
Ccr6 T G 17: 8,256,046 C28G probably damaging Het
Cdca7l A G 12: 117,865,167 probably benign Het
Cnot3 T C 7: 3,651,329 I52T probably damaging Het
Cped1 A T 6: 22,138,687 N555I probably benign Het
Cpne6 A T 14: 55,516,254 I390F probably damaging Het
Dlec1 A G 9: 119,128,351 D836G probably benign Het
Dnah8 T A 17: 30,851,654 V4438D probably damaging Het
Dok3 G T 13: 55,523,722 N345K probably damaging Het
Eea1 C T 10: 96,019,879 Q593* probably null Het
Eif3m T C 2: 104,999,794 Y351C possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Epn3 T C 11: 94,496,088 E152G probably damaging Het
Faf2 A G 13: 54,621,913 S25G probably benign Het
Fam83b A G 9: 76,493,075 S249P probably damaging Het
Fgl1 A T 8: 41,200,459 S132R probably benign Het
Frem3 A G 8: 80,669,246 E1890G probably damaging Het
Gm960 T C 19: 4,645,686 I513V possibly damaging Het
Gpc5 T A 14: 115,092,686 S94T unknown Het
Hectd1 A G 12: 51,744,627 V2584A probably damaging Het
Kifc3 G A 8: 95,106,476 A498V probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Lor T C 3: 92,081,139 Y280C unknown Het
Lpin2 C T 17: 71,246,967 A931V unknown Het
Lpxn A G 19: 12,833,158 H322R probably damaging Het
Megf9 A G 4: 70,435,397 S391P probably benign Het
Mipep G A 14: 60,843,253 V565I probably benign Het
Mmrn1 C T 6: 60,976,058 T441I probably benign Het
Mpp5 G A 12: 78,837,524 D640N probably damaging Het
Mrpl48 T C 7: 100,574,495 N14S probably benign Het
Ncald A G 15: 37,397,268 F56S probably damaging Het
Olfr1012 T C 2: 85,753,907 probably benign Het
Plcd3 A G 11: 103,071,266 V703A possibly damaging Het
Qser1 T C 2: 104,787,357 I947V probably benign Het
Rnf213 A G 11: 119,430,349 D1211G Het
Sbpl T C 17: 23,953,279 D222G unknown Het
Scn8a C A 15: 101,002,149 T703K possibly damaging Het
Setbp1 A G 18: 78,859,244 S403P probably benign Het
Sfmbt2 A G 2: 10,404,456 S71G probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,036 probably benign Het
Smco3 C T 6: 136,831,732 G48D possibly damaging Het
Spag9 T C 11: 94,067,989 S280P probably benign Het
Thada T C 17: 84,231,087 T1498A probably benign Het
Tmprss7 T C 16: 45,660,900 D641G probably damaging Het
Trim43a A G 9: 88,582,351 D105G probably benign Het
Utp14b T A 1: 78,665,286 N300K probably benign Het
Vmn2r83 T G 10: 79,491,526 I656S probably damaging Het
Zfp646 A T 7: 127,881,605 M985L probably benign Het
Zfp777 A T 6: 48,029,224 L412Q probably damaging Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 52086346 missense probably damaging 1.00
IGL02088:Rdx APN 9 52060883 utr 5 prime probably benign
IGL02522:Rdx APN 9 52068204 missense possibly damaging 0.92
R0731:Rdx UTSW 9 52068218 missense probably benign 0.05
R0748:Rdx UTSW 9 52064860 missense possibly damaging 0.87
R0831:Rdx UTSW 9 52065817 missense probably damaging 1.00
R1605:Rdx UTSW 9 52063591 missense probably damaging 1.00
R1688:Rdx UTSW 9 52060911 splice site probably benign
R2127:Rdx UTSW 9 52069732 missense possibly damaging 0.49
R2363:Rdx UTSW 9 52068873 missense probably damaging 1.00
R2899:Rdx UTSW 9 52068911 splice site probably benign
R4184:Rdx UTSW 9 52067380 missense probably damaging 1.00
R4569:Rdx UTSW 9 52068841 missense probably benign 0.07
R4607:Rdx UTSW 9 52068837 missense probably damaging 0.99
R4760:Rdx UTSW 9 52065874 missense probably benign 0.02
R4820:Rdx UTSW 9 52063591 missense probably damaging 1.00
R4966:Rdx UTSW 9 52075009 missense probably benign 0.00
R6707:Rdx UTSW 9 52063654 missense probably damaging 1.00
R7136:Rdx UTSW 9 52086445 missense probably damaging 1.00
R7308:Rdx UTSW 9 52068870 missense probably damaging 0.98
R7597:Rdx UTSW 9 52060896 missense possibly damaging 0.84
R7835:Rdx UTSW 9 52065788 missense probably damaging 0.98
R7923:Rdx UTSW 9 52065901 missense possibly damaging 0.93
R8055:Rdx UTSW 9 52086424 missense probably damaging 1.00
R8057:Rdx UTSW 9 52065646 missense probably damaging 1.00
R8889:Rdx UTSW 9 52086453 missense probably damaging 1.00
R9128:Rdx UTSW 9 52064879 nonsense probably null
R9226:Rdx UTSW 9 52081168 missense probably benign 0.01
R9377:Rdx UTSW 9 52068868 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGAACATTGCAATAGGCCAAGC -3'
(R):5'- TGGCCTTAGCATGTTCACCC -3'

Sequencing Primer
(F):5'- TCCCATGGGAAGACTAGCTC -3'
(R):5'- TTAGCATGTTCACCCCACCAAC -3'
Posted On 2021-10-11