Incidental Mutation 'R8983:Rdx'
ID 683829
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 068816-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8983 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51974905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 14 (A14T)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: A14T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: A14T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: A14T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: A14T

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,313,272 (GRCm39) F632I unknown Het
5730522E02Rik T C 11: 25,719,069 (GRCm39) T26A unknown Het
Ablim1 A T 19: 57,227,644 (GRCm39) V7E probably benign Het
Adcy5 T G 16: 34,977,232 (GRCm39) L255R possibly damaging Het
Ahnak C A 19: 8,981,477 (GRCm39) N920K possibly damaging Het
Arhgef11 A G 3: 87,640,508 (GRCm39) K1251E Het
Astn1 T A 1: 158,491,700 (GRCm39) probably null Het
Atxn2 A G 5: 121,916,063 (GRCm39) Y423C probably damaging Het
Ccdc180 T A 4: 45,909,359 (GRCm39) V509D possibly damaging Het
Ccdc80 T C 16: 44,924,780 (GRCm39) V638A possibly damaging Het
Ccr6 T G 17: 8,474,878 (GRCm39) C28G probably damaging Het
Cdca7l A G 12: 117,828,902 (GRCm39) probably benign Het
Cnot3 T C 7: 3,654,328 (GRCm39) I52T probably damaging Het
Cped1 A T 6: 22,138,686 (GRCm39) N555I probably benign Het
Cpne6 A T 14: 55,753,711 (GRCm39) I390F probably damaging Het
Dlec1 A G 9: 118,957,419 (GRCm39) D836G probably benign Het
Dnah8 T A 17: 31,070,628 (GRCm39) V4438D probably damaging Het
Dok3 G T 13: 55,671,535 (GRCm39) N345K probably damaging Het
Eea1 C T 10: 95,855,741 (GRCm39) Q593* probably null Het
Eif3m T C 2: 104,830,139 (GRCm39) Y351C possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Epn3 T C 11: 94,386,914 (GRCm39) E152G probably damaging Het
Faf2 A G 13: 54,769,726 (GRCm39) S25G probably benign Het
Fam83b A G 9: 76,400,357 (GRCm39) S249P probably damaging Het
Fgl1 A T 8: 41,653,496 (GRCm39) S132R probably benign Het
Frem3 A G 8: 81,395,875 (GRCm39) E1890G probably damaging Het
Gpc5 T A 14: 115,330,118 (GRCm39) S94T unknown Het
Hectd1 A G 12: 51,791,410 (GRCm39) V2584A probably damaging Het
Kifc3 G A 8: 95,833,104 (GRCm39) A498V probably damaging Het
Klra6 T C 6: 129,999,573 (GRCm39) T132A probably benign Het
Loricrin T C 3: 91,988,446 (GRCm39) Y280C unknown Het
Lpin2 C T 17: 71,553,962 (GRCm39) A931V unknown Het
Lpxn A G 19: 12,810,522 (GRCm39) H322R probably damaging Het
Megf9 A G 4: 70,353,634 (GRCm39) S391P probably benign Het
Mipep G A 14: 61,080,702 (GRCm39) V565I probably benign Het
Mmrn1 C T 6: 60,953,042 (GRCm39) T441I probably benign Het
Mrpl48 T C 7: 100,223,702 (GRCm39) N14S probably benign Het
Ncald A G 15: 37,397,512 (GRCm39) F56S probably damaging Het
Or9g3 T C 2: 85,584,251 (GRCm39) probably benign Het
Pals1 G A 12: 78,884,298 (GRCm39) D640N probably damaging Het
Plcd3 A G 11: 102,962,092 (GRCm39) V703A possibly damaging Het
Potefam1 A G 2: 111,030,701 (GRCm39) S403P probably benign Het
Prss59 A G 6: 40,897,934 (GRCm39) S250P possibly damaging Het
Qser1 T C 2: 104,617,702 (GRCm39) I947V probably benign Het
Rnf213 A G 11: 119,321,175 (GRCm39) D1211G Het
Sbpl T C 17: 24,172,253 (GRCm39) D222G unknown Het
Scn8a C A 15: 100,900,030 (GRCm39) T703K possibly damaging Het
Setbp1 A G 18: 78,902,459 (GRCm39) S403P probably benign Het
Sfmbt2 A G 2: 10,409,267 (GRCm39) S71G probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,775 (GRCm39) probably benign Het
Smco3 C T 6: 136,808,730 (GRCm39) G48D possibly damaging Het
Spag9 T C 11: 93,958,815 (GRCm39) S280P probably benign Het
Thada T C 17: 84,538,515 (GRCm39) T1498A probably benign Het
Tmprss7 T C 16: 45,481,263 (GRCm39) D641G probably damaging Het
Top6bl T C 19: 4,695,714 (GRCm39) I513V possibly damaging Het
Trim43a A G 9: 88,464,404 (GRCm39) D105G probably benign Het
Utp14b T A 1: 78,643,003 (GRCm39) N300K probably benign Het
Vmn2r83 T G 10: 79,327,360 (GRCm39) I656S probably damaging Het
Zfp646 A T 7: 127,480,777 (GRCm39) M985L probably benign Het
Zfp777 A T 6: 48,006,158 (GRCm39) L412Q probably damaging Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACATTGCAATAGGCCAAGC -3'
(R):5'- TGGCCTTAGCATGTTCACCC -3'

Sequencing Primer
(F):5'- TCCCATGGGAAGACTAGCTC -3'
(R):5'- TTAGCATGTTCACCCCACCAAC -3'
Posted On 2021-10-11