Incidental Mutation 'R8984:Stk17b'
ID 683864
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R8984 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53755506-53785224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53757625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 328 (S328A)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect probably benign
Transcript: ENSMUST00000027263
AA Change: S328A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: S328A

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,351,815 V10E probably benign Het
Adss A T 1: 177,773,714 probably benign Het
AI467606 A T 7: 127,092,501 I83F probably damaging Het
Atn1 A T 6: 124,746,960 W437R unknown Het
Atxn7l2 T C 3: 108,208,974 probably benign Het
AU040320 T C 4: 126,841,143 F750S possibly damaging Het
B3gnt6 A G 7: 98,193,614 S380P probably benign Het
Bod1l T C 5: 41,788,872 Q3020R probably damaging Het
Borcs6 A T 11: 69,060,002 I69F probably benign Het
Brd7 T A 8: 88,354,712 M170L probably benign Het
Ccdc191 T A 16: 43,890,218 probably benign Het
Cit C T 5: 115,926,475 T472I possibly damaging Het
Ddx25 G T 9: 35,557,389 D57E probably benign Het
Dnah7a A T 1: 53,635,277 L447* probably null Het
Epb41l3 A G 17: 69,247,646 D247G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etaa1 A T 11: 17,940,254 V869E probably damaging Het
Exoc8 T A 8: 124,896,030 I533F probably benign Het
Fam117a A G 11: 95,363,997 probably null Het
Fam222a C T 5: 114,611,031 T96I possibly damaging Het
Fam71b C A 11: 46,404,868 Y22* probably null Het
Farsa C T 8: 84,867,599 T326I probably damaging Het
Fkbp1b T A 12: 4,841,401 D12V probably damaging Het
Gc C T 5: 89,441,562 probably null Het
Git2 T C 5: 114,730,195 E705G probably damaging Het
Gm10318 G A 10: 77,853,244 C128Y unknown Het
Hcar2 G A 5: 123,864,508 R311* probably null Het
Hira A G 16: 18,927,511 Q468R possibly damaging Het
Hist1h3c C A 13: 23,745,410 A30S probably benign Het
Hspa1l T C 17: 34,978,116 V377A probably damaging Het
Igkv2-137 T A 6: 67,555,675 W14R probably damaging Het
Itga3 A T 11: 95,062,565 L317Q probably damaging Het
Jade2 A C 11: 51,825,079 L433W probably damaging Het
Kif21a T C 15: 90,956,356 T1186A probably benign Het
Krtap28-10 C A 1: 83,042,173 C82F unknown Het
Ksr1 G A 11: 79,040,883 T333M probably damaging Het
Msi1 T C 5: 115,435,539 F132S probably damaging Het
Myo7b C A 18: 31,966,349 K1673N probably null Het
Myom3 T A 4: 135,787,944 N716K Het
Ndst4 G A 3: 125,722,161 G312R probably damaging Het
Ndufaf2 A G 13: 108,052,782 V144A probably benign Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr328 G C 11: 58,551,383 N285K probably damaging Het
Olfr558 T A 7: 102,710,012 I251N possibly damaging Het
Olfr594 T C 7: 103,220,186 L156P possibly damaging Het
Olfr628 T C 7: 103,732,013 I29T probably damaging Het
Olfr64 G A 7: 103,893,609 T42I probably benign Het
Omd T C 13: 49,590,100 S209P possibly damaging Het
Patl1 T A 19: 11,921,396 Y152N probably damaging Het
Plaur T A 7: 24,465,152 M27K probably benign Het
Ppfia2 T A 10: 106,858,578 probably benign Het
Ppfia3 A G 7: 45,340,676 V1142A probably damaging Het
Psg28 T A 7: 18,423,056 N418I probably damaging Het
Ptprd A T 4: 75,945,014 F1237I probably damaging Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rbms3 A T 9: 116,695,818 probably null Het
Rgs18 A G 1: 144,753,828 V231A probably benign Het
Rnf112 T C 11: 61,452,451 R156G possibly damaging Het
Rsad1 A C 11: 94,548,184 V150G probably damaging Het
Rxrg G A 1: 167,634,436 V350I possibly damaging Het
Sash1 A G 10: 8,751,044 I192T possibly damaging Het
Slc25a36 G A 9: 97,079,206 T259I probably benign Het
Smarcd3 T A 5: 24,593,988 E324V probably null Het
St3gal4 A G 9: 35,055,648 V2A possibly damaging Het
Tbrg1 A G 9: 37,652,653 Y229H probably damaging Het
Tdg A G 10: 82,648,680 N409S probably benign Het
Terb1 T C 8: 104,485,404 E315G possibly damaging Het
Tmem131 A G 1: 36,828,147 F402L probably benign Het
Trav4-2 T C 14: 53,418,733 I64T probably benign Het
Trav4-4-dv10 A G 14: 53,684,117 T91A probably benign Het
Xdh C T 17: 73,921,351 G352R probably damaging Het
Zfp551 C A 7: 12,422,632 probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1375:Stk17b UTSW 1 53765947 missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53757590 missense probably damaging 1.00
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2033:Stk17b UTSW 1 53761076 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4892:Stk17b UTSW 1 53771611 missense probably damaging 0.99
R4999:Stk17b UTSW 1 53761147 splice site probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6636:Stk17b UTSW 1 53761088 missense probably damaging 1.00
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
R9476:Stk17b UTSW 1 53757739 missense probably damaging 1.00
R9510:Stk17b UTSW 1 53757739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCAGTCCAGATGAGTCAC -3'
(R):5'- ACGTGCTGTCTTCATGCTG -3'

Sequencing Primer
(F):5'- TCCAGATGAGTCACAGAGAAAAATGC -3'
(R):5'- TCTTGGAAGACATGCTCAGC -3'
Posted On 2021-10-11