Incidental Mutation 'R8984:Myo7b'
ID 683930
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 068817-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8984 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32099402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1673 (K1673N)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably null
Transcript: ENSMUST00000134663
AA Change: K1673N

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: K1673N

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,180,880 (GRCm39) V10E probably benign Het
Adss2 A T 1: 177,601,280 (GRCm39) probably benign Het
AI467606 A T 7: 126,691,673 (GRCm39) I83F probably damaging Het
Atn1 A T 6: 124,723,923 (GRCm39) W437R unknown Het
Atxn7l2 T C 3: 108,116,290 (GRCm39) probably benign Het
AU040320 T C 4: 126,734,936 (GRCm39) F750S possibly damaging Het
B3gnt6 A G 7: 97,842,821 (GRCm39) S380P probably benign Het
Bod1l T C 5: 41,946,215 (GRCm39) Q3020R probably damaging Het
Borcs6 A T 11: 68,950,828 (GRCm39) I69F probably benign Het
Brd7 T A 8: 89,081,340 (GRCm39) M170L probably benign Het
Ccdc191 T A 16: 43,710,581 (GRCm39) probably benign Het
Cit C T 5: 116,064,534 (GRCm39) T472I possibly damaging Het
Ddx25 G T 9: 35,468,685 (GRCm39) D57E probably benign Het
Dnah7a A T 1: 53,674,436 (GRCm39) L447* probably null Het
Epb41l3 A G 17: 69,554,641 (GRCm39) D247G probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etaa1 A T 11: 17,890,254 (GRCm39) V869E probably damaging Het
Exoc8 T A 8: 125,622,769 (GRCm39) I533F probably benign Het
Fam117a A G 11: 95,254,823 (GRCm39) probably null Het
Fam222a C T 5: 114,749,092 (GRCm39) T96I possibly damaging Het
Farsa C T 8: 85,594,228 (GRCm39) T326I probably damaging Het
Fkbp1b T A 12: 4,891,401 (GRCm39) D12V probably damaging Het
Garin3 C A 11: 46,295,695 (GRCm39) Y22* probably null Het
Gc C T 5: 89,589,421 (GRCm39) probably null Het
Git2 T C 5: 114,868,256 (GRCm39) E705G probably damaging Het
Gm10318 G A 10: 77,689,078 (GRCm39) C128Y unknown Het
H3c3 C A 13: 23,929,393 (GRCm39) A30S probably benign Het
Hcar2 G A 5: 124,002,571 (GRCm39) R311* probably null Het
Hira A G 16: 18,746,261 (GRCm39) Q468R possibly damaging Het
Hspa1l T C 17: 35,197,092 (GRCm39) V377A probably damaging Het
Igkv2-137 T A 6: 67,532,659 (GRCm39) W14R probably damaging Het
Itga3 A T 11: 94,953,391 (GRCm39) L317Q probably damaging Het
Jade2 A C 11: 51,715,906 (GRCm39) L433W probably damaging Het
Kif21a T C 15: 90,840,559 (GRCm39) T1186A probably benign Het
Krtap28-10 C A 1: 83,019,894 (GRCm39) C82F unknown Het
Ksr1 G A 11: 78,931,709 (GRCm39) T333M probably damaging Het
Msi1 T C 5: 115,573,598 (GRCm39) F132S probably damaging Het
Myom3 T A 4: 135,515,255 (GRCm39) N716K Het
Ndst4 G A 3: 125,515,810 (GRCm39) G312R probably damaging Het
Ndufaf2 A G 13: 108,189,316 (GRCm39) V144A probably benign Het
Omd T C 13: 49,743,576 (GRCm39) S209P possibly damaging Het
Or2n1c A G 17: 38,519,304 (GRCm39) H56R probably damaging Het
Or2t47 G C 11: 58,442,209 (GRCm39) N285K probably damaging Het
Or51b17 G A 7: 103,542,816 (GRCm39) T42I probably benign Het
Or51e1 T A 7: 102,359,219 (GRCm39) I251N possibly damaging Het
Or52a24 T C 7: 103,381,220 (GRCm39) I29T probably damaging Het
Or52e3 T C 7: 102,869,393 (GRCm39) L156P possibly damaging Het
Patl1 T A 19: 11,898,760 (GRCm39) Y152N probably damaging Het
Plaur T A 7: 24,164,577 (GRCm39) M27K probably benign Het
Ppfia2 T A 10: 106,694,439 (GRCm39) probably benign Het
Ppfia3 A G 7: 44,990,100 (GRCm39) V1142A probably damaging Het
Psg28 T A 7: 18,156,981 (GRCm39) N418I probably damaging Het
Ptprd A T 4: 75,863,251 (GRCm39) F1237I probably damaging Het
Ptprj G A 2: 90,270,987 (GRCm39) P1247L probably damaging Het
Rbms3 A T 9: 116,524,886 (GRCm39) probably null Het
Rgs18 A G 1: 144,629,566 (GRCm39) V231A probably benign Het
Rnf112 T C 11: 61,343,277 (GRCm39) R156G possibly damaging Het
Rsad1 A C 11: 94,439,010 (GRCm39) V150G probably damaging Het
Rxrg G A 1: 167,462,005 (GRCm39) V350I possibly damaging Het
Sash1 A G 10: 8,626,808 (GRCm39) I192T possibly damaging Het
Slc25a36 G A 9: 96,961,259 (GRCm39) T259I probably benign Het
Smarcd3 T A 5: 24,798,986 (GRCm39) E324V probably null Het
St3gal4 A G 9: 34,966,944 (GRCm39) V2A possibly damaging Het
Stk17b A C 1: 53,796,784 (GRCm39) S328A probably benign Het
Tbrg1 A G 9: 37,563,949 (GRCm39) Y229H probably damaging Het
Tdg A G 10: 82,484,514 (GRCm39) N409S probably benign Het
Terb1 T C 8: 105,212,036 (GRCm39) E315G possibly damaging Het
Tmem131 A G 1: 36,867,228 (GRCm39) F402L probably benign Het
Trav4-2 T C 14: 53,656,190 (GRCm39) I64T probably benign Het
Trav4-4-dv10 A G 14: 53,921,574 (GRCm39) T91A probably benign Het
Xdh C T 17: 74,228,346 (GRCm39) G352R probably damaging Het
Zfp551 C A 7: 12,156,559 (GRCm39) probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATATGTGGCTGTTTCCCC -3'
(R):5'- ACTGGTCCAGAGGTCAACTG -3'

Sequencing Primer
(F):5'- TAGCAGAGGCATATCCCAGCG -3'
(R):5'- CAACTGGGGACTTGGTTCAG -3'
Posted On 2021-10-11