Incidental Mutation 'R8985:Ttc41'
ID 683978
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8985 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86731092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 541 (I541F)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000075632
AA Change: I541F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: I541F

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000219108
AA Change: I541F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C A 7: 76,320,156 S53R Het
Ahr T C 12: 35,526,737 K65R possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankrd52 T C 10: 128,387,109 S643P probably damaging Het
Asz1 T C 6: 18,051,337 T448A probably benign Het
Atp10a A G 7: 58,788,344 I425V probably benign Het
Casd1 T A 6: 4,624,399 Y397* probably null Het
Ccdc162 A G 10: 41,556,106 I1797T probably damaging Het
Cdc20b A T 13: 113,059,796 R152* probably null Het
Cdc25b T C 2: 131,193,260 C313R probably damaging Het
Cfap73 T A 5: 120,630,058 T212S probably benign Het
Chd9 G T 8: 90,994,473 R963L unknown Het
Clip4 G T 17: 71,806,532 V226F probably damaging Het
Cmya5 A G 13: 93,097,156 S475P possibly damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Crtc1 T G 8: 70,402,442 H176P probably damaging Het
Cspg5 T C 9: 110,256,434 W558R unknown Het
Cyp2c39 A G 19: 39,563,975 T371A probably benign Het
Dcaf8 G A 1: 172,172,632 R119H probably benign Het
Drosha G T 15: 12,924,101 A1190S possibly damaging Het
Dst T C 1: 34,249,805 V5655A probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Flnc T A 6: 29,440,500 V269D probably benign Het
Foxs1 T A 2: 152,933,138 probably benign Het
Ftsj3 T C 11: 106,250,769 Y551C possibly damaging Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Grm6 C T 11: 50,855,710 A289V possibly damaging Het
Hook1 A G 4: 96,022,231 D694G probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igha T C 12: 113,258,991 E270G Het
Jade1 A C 3: 41,613,713 S739R probably benign Het
Lpin3 T C 2: 160,896,754 S209P probably benign Het
Ly6i A C 15: 74,979,957 L121R probably damaging Het
Ms4a1 C T 19: 11,254,691 V107I probably benign Het
Mycbpap T A 11: 94,513,896 T74S probably benign Het
Nlrp14 A G 7: 107,197,229 N921D probably benign Het
Nmur1 C T 1: 86,386,381 E388K probably benign Het
Nol4 T C 18: 22,952,237 Y40C probably damaging Het
Olfr376 T C 11: 73,375,426 S229P possibly damaging Het
Olfr639 A T 7: 104,012,160 C181S probably damaging Het
Olfr916 A T 9: 38,658,325 Y22* probably null Het
Pawr G A 10: 108,412,000 V283M possibly damaging Het
Pde6b T C 5: 108,430,637 Y814H probably benign Het
Pds5b T A 5: 150,800,774 L1272H probably benign Het
Pkd1l2 T C 8: 117,038,110 T1350A probably benign Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcz1 T A 6: 140,016,177 Q216L possibly damaging Het
Prodh A T 16: 18,072,498 C522S probably null Het
Rasef G T 4: 73,790,723 P91Q possibly damaging Het
Rnase6 A T 14: 51,130,175 Y8F unknown Het
Rnf216 T A 5: 143,090,425 T235S probably benign Het
Slco2a1 G A 9: 103,072,635 probably null Het
Smoc1 A G 12: 81,179,487 E362G probably damaging Het
Sncaip T C 18: 52,869,097 L230P probably benign Het
Tdrd3 A G 14: 87,506,161 E515G possibly damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tmem9 T A 1: 136,027,407 V93D possibly damaging Het
Tpm3-rs7 A C 14: 113,315,324 I217L probably benign Het
Uck2 T C 1: 167,243,112 D16G probably benign Het
Vmn1r50 A G 6: 90,108,035 D254G probably benign Het
Vmn2r50 A C 7: 10,046,047 F469C probably damaging Het
Vmn2r57 A G 7: 41,399,835 V830A probably benign Het
Wwc2 T A 8: 47,878,884 R299S probably benign Het
Xdh C T 17: 73,921,351 G352R probably damaging Het
Xkr9 A T 1: 13,700,766 M169L probably benign Het
Zbtb10 A G 3: 9,280,747 D767G probably damaging Het
Zfp106 T C 2: 120,535,596 Y65C Het
Zfp536 A G 7: 37,568,803 L396P probably damaging Het
Znhit1 C A 5: 136,982,554 C135F probably damaging Het
Zscan5b A G 7: 6,238,835 E351G probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAATTCATTCTGAGCAGCGTCTC -3'
(R):5'- TCACACACCTGGAATCACGG -3'

Sequencing Primer
(F):5'- AGTCTGTCCTGCAAGTCGCTG -3'
(R):5'- ACACCTGGAATCACGGTGTCTAG -3'
Posted On 2021-10-11