Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R8985:Ahr'
ID 683985
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
Accession Numbers

Genbank: NM_013464; MGI: 105043

  
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R8985 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35497974-35535038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35526737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 65 (K65R)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110811
AA Change: K65R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256
AA Change: K65R

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116436
AA Change: K65R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: K65R

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C A 7: 76,320,156 S53R Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankrd52 T C 10: 128,387,109 S643P probably damaging Het
Asz1 T C 6: 18,051,337 T448A probably benign Het
Atp10a A G 7: 58,788,344 I425V probably benign Het
Casd1 T A 6: 4,624,399 Y397* probably null Het
Ccdc162 A G 10: 41,556,106 I1797T probably damaging Het
Cdc20b A T 13: 113,059,796 R152* probably null Het
Cdc25b T C 2: 131,193,260 C313R probably damaging Het
Cfap73 T A 5: 120,630,058 T212S probably benign Het
Chd9 G T 8: 90,994,473 R963L unknown Het
Clip4 G T 17: 71,806,532 V226F probably damaging Het
Cmya5 A G 13: 93,097,156 S475P possibly damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Crtc1 T G 8: 70,402,442 H176P probably damaging Het
Cspg5 T C 9: 110,256,434 W558R unknown Het
Cyp2c39 A G 19: 39,563,975 T371A probably benign Het
Dcaf8 G A 1: 172,172,632 R119H probably benign Het
Drosha G T 15: 12,924,101 A1190S possibly damaging Het
Dst T C 1: 34,249,805 V5655A probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Flnc T A 6: 29,440,500 V269D probably benign Het
Foxs1 T A 2: 152,933,138 probably benign Het
Ftsj3 T C 11: 106,250,769 Y551C possibly damaging Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Grm6 C T 11: 50,855,710 A289V possibly damaging Het
Hook1 A G 4: 96,022,231 D694G probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igha T C 12: 113,258,991 E270G Het
Jade1 A C 3: 41,613,713 S739R probably benign Het
Lpin3 T C 2: 160,896,754 S209P probably benign Het
Ly6i A C 15: 74,979,957 L121R probably damaging Het
Ms4a1 C T 19: 11,254,691 V107I probably benign Het
Mycbpap T A 11: 94,513,896 T74S probably benign Het
Nlrp14 A G 7: 107,197,229 N921D probably benign Het
Nmur1 C T 1: 86,386,381 E388K probably benign Het
Nol4 T C 18: 22,952,237 Y40C probably damaging Het
Olfr376 T C 11: 73,375,426 S229P possibly damaging Het
Olfr639 A T 7: 104,012,160 C181S probably damaging Het
Olfr916 A T 9: 38,658,325 Y22* probably null Het
Pawr G A 10: 108,412,000 V283M possibly damaging Het
Pde6b T C 5: 108,430,637 Y814H probably benign Het
Pds5b T A 5: 150,800,774 L1272H probably benign Het
Pkd1l2 T C 8: 117,038,110 T1350A probably benign Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcz1 T A 6: 140,016,177 Q216L possibly damaging Het
Prodh A T 16: 18,072,498 C522S probably null Het
Rasef G T 4: 73,790,723 P91Q possibly damaging Het
Rnase6 A T 14: 51,130,175 Y8F unknown Het
Rnf216 T A 5: 143,090,425 T235S probably benign Het
Slco2a1 G A 9: 103,072,635 probably null Het
Smoc1 A G 12: 81,179,487 E362G probably damaging Het
Sncaip T C 18: 52,869,097 L230P probably benign Het
Tdrd3 A G 14: 87,506,161 E515G possibly damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tmem9 T A 1: 136,027,407 V93D possibly damaging Het
Tpm3-rs7 A C 14: 113,315,324 I217L probably benign Het
Ttc41 A T 10: 86,731,092 I541F possibly damaging Het
Uck2 T C 1: 167,243,112 D16G probably benign Het
Vmn1r50 A G 6: 90,108,035 D254G probably benign Het
Vmn2r50 A C 7: 10,046,047 F469C probably damaging Het
Vmn2r57 A G 7: 41,399,835 V830A probably benign Het
Wwc2 T A 8: 47,878,884 R299S probably benign Het
Xdh C T 17: 73,921,351 G352R probably damaging Het
Xkr9 A T 1: 13,700,766 M169L probably benign Het
Zbtb10 A G 3: 9,280,747 D767G probably damaging Het
Zfp106 T C 2: 120,535,596 Y65C Het
Zfp536 A G 7: 37,568,803 L396P probably damaging Het
Znhit1 C A 5: 136,982,554 C135F probably damaging Het
Zscan5b A G 7: 6,238,835 E351G probably damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
BB002:Ahr UTSW 12 35515068 nonsense probably null
BB012:Ahr UTSW 12 35515068 nonsense probably null
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R0784:Ahr UTSW 12 35508142 missense possibly damaging 0.79
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
R7925:Ahr UTSW 12 35515068 nonsense probably null
R8179:Ahr UTSW 12 35510051 missense probably benign 0.01
R8274:Ahr UTSW 12 35510069 missense probably benign
R8342:Ahr UTSW 12 35508272 missense probably damaging 1.00
R9114:Ahr UTSW 12 35511165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAACAGCTCCATTGTCC -3'
(R):5'- AGGGGACGTTTTAATGTTAGACAC -3'

Sequencing Primer
(F):5'- TTGTCCATCAATGAAACAGGAAAG -3'
(R):5'- GACACTTTTGCTCTGTTTTCTAAAGG -3'
Posted On 2021-10-11