Incidental Mutation 'R8985:Tdrd3'
ID 683991
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock # R8985 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87506161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 515 (E515G)
Ref Sequence ENSEMBL: ENSMUSP00000129019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
PDB Structure Solution structure of the Tudor domain of Tudor domain containing protein 3 from mouse [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168275
AA Change: E515G

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: E515G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169504
AA Change: E515G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: E515G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170865
AA Change: E509G

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: E509G

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C A 7: 76,320,156 S53R Het
Ahr T C 12: 35,526,737 K65R possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankrd52 T C 10: 128,387,109 S643P probably damaging Het
Asz1 T C 6: 18,051,337 T448A probably benign Het
Atp10a A G 7: 58,788,344 I425V probably benign Het
Casd1 T A 6: 4,624,399 Y397* probably null Het
Ccdc162 A G 10: 41,556,106 I1797T probably damaging Het
Cdc20b A T 13: 113,059,796 R152* probably null Het
Cdc25b T C 2: 131,193,260 C313R probably damaging Het
Cfap73 T A 5: 120,630,058 T212S probably benign Het
Chd9 G T 8: 90,994,473 R963L unknown Het
Clip4 G T 17: 71,806,532 V226F probably damaging Het
Cmya5 A G 13: 93,097,156 S475P possibly damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Crtc1 T G 8: 70,402,442 H176P probably damaging Het
Cspg5 T C 9: 110,256,434 W558R unknown Het
Cyp2c39 A G 19: 39,563,975 T371A probably benign Het
Dcaf8 G A 1: 172,172,632 R119H probably benign Het
Drosha G T 15: 12,924,101 A1190S possibly damaging Het
Dst T C 1: 34,249,805 V5655A probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Flnc T A 6: 29,440,500 V269D probably benign Het
Foxs1 T A 2: 152,933,138 probably benign Het
Ftsj3 T C 11: 106,250,769 Y551C possibly damaging Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Grm6 C T 11: 50,855,710 A289V possibly damaging Het
Hook1 A G 4: 96,022,231 D694G probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igha T C 12: 113,258,991 E270G Het
Jade1 A C 3: 41,613,713 S739R probably benign Het
Lpin3 T C 2: 160,896,754 S209P probably benign Het
Ly6i A C 15: 74,979,957 L121R probably damaging Het
Ms4a1 C T 19: 11,254,691 V107I probably benign Het
Mycbpap T A 11: 94,513,896 T74S probably benign Het
Nlrp14 A G 7: 107,197,229 N921D probably benign Het
Nmur1 C T 1: 86,386,381 E388K probably benign Het
Nol4 T C 18: 22,952,237 Y40C probably damaging Het
Olfr376 T C 11: 73,375,426 S229P possibly damaging Het
Olfr639 A T 7: 104,012,160 C181S probably damaging Het
Olfr916 A T 9: 38,658,325 Y22* probably null Het
Pawr G A 10: 108,412,000 V283M possibly damaging Het
Pde6b T C 5: 108,430,637 Y814H probably benign Het
Pds5b T A 5: 150,800,774 L1272H probably benign Het
Pkd1l2 T C 8: 117,038,110 T1350A probably benign Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcz1 T A 6: 140,016,177 Q216L possibly damaging Het
Prodh A T 16: 18,072,498 C522S probably null Het
Rasef G T 4: 73,790,723 P91Q possibly damaging Het
Rnase6 A T 14: 51,130,175 Y8F unknown Het
Rnf216 T A 5: 143,090,425 T235S probably benign Het
Slco2a1 G A 9: 103,072,635 probably null Het
Smoc1 A G 12: 81,179,487 E362G probably damaging Het
Sncaip T C 18: 52,869,097 L230P probably benign Het
Tipin T A 9: 64,288,103 probably null Het
Tmem9 T A 1: 136,027,407 V93D possibly damaging Het
Tpm3-rs7 A C 14: 113,315,324 I217L probably benign Het
Ttc41 A T 10: 86,731,092 I541F possibly damaging Het
Uck2 T C 1: 167,243,112 D16G probably benign Het
Vmn1r50 A G 6: 90,108,035 D254G probably benign Het
Vmn2r50 A C 7: 10,046,047 F469C probably damaging Het
Vmn2r57 A G 7: 41,399,835 V830A probably benign Het
Wwc2 T A 8: 47,878,884 R299S probably benign Het
Xdh C T 17: 73,921,351 G352R probably damaging Het
Xkr9 A T 1: 13,700,766 M169L probably benign Het
Zbtb10 A G 3: 9,280,747 D767G probably damaging Het
Zfp106 T C 2: 120,535,596 Y65C Het
Zfp536 A G 7: 37,568,803 L396P probably damaging Het
Znhit1 C A 5: 136,982,554 C135F probably damaging Het
Zscan5b A G 7: 6,238,835 E351G probably damaging Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAGTAGTTCCTCAGGTTCTG -3'
(R):5'- TTTGGAACACCAAGACTATTGC -3'

Sequencing Primer
(F):5'- CAGGTTCTGATGTATGGGCAGAAG -3'
(R):5'- AGACTATTGCTCTGCACAGG -3'
Posted On 2021-10-11