Incidental Mutation 'R8985:Xdh'
ID 683998
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 068818-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R8985 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74228346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 352 (G352R)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: G352R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: G352R

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.9552 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,141,860 (GRCm39) probably benign Het
Agbl1 C A 7: 75,969,904 (GRCm39) S53R Het
Ahr T C 12: 35,576,736 (GRCm39) K65R possibly damaging Het
AI429214 A T 8: 37,460,820 (GRCm39) probably benign Het
Ankrd52 T C 10: 128,222,978 (GRCm39) S643P probably damaging Het
Asz1 T C 6: 18,051,336 (GRCm39) T448A probably benign Het
Atp10a A G 7: 58,438,092 (GRCm39) I425V probably benign Het
Casd1 T A 6: 4,624,399 (GRCm39) Y397* probably null Het
Ccdc162 A G 10: 41,432,102 (GRCm39) I1797T probably damaging Het
Cdc20b A T 13: 113,196,330 (GRCm39) R152* probably null Het
Cdc25b T C 2: 131,035,180 (GRCm39) C313R probably damaging Het
Cfap73 T A 5: 120,768,123 (GRCm39) T212S probably benign Het
Chd9 G T 8: 91,721,101 (GRCm39) R963L unknown Het
Clip4 G T 17: 72,113,527 (GRCm39) V226F probably damaging Het
Cmya5 A G 13: 93,233,664 (GRCm39) S475P possibly damaging Het
Cntn5 A G 9: 10,171,960 (GRCm39) Y75H possibly damaging Het
Crtc1 T G 8: 70,855,092 (GRCm39) H176P probably damaging Het
Cspg5 T C 9: 110,085,502 (GRCm39) W558R unknown Het
Cyp2c39 A G 19: 39,552,419 (GRCm39) T371A probably benign Het
Dcaf8 G A 1: 172,000,199 (GRCm39) R119H probably benign Het
Drosha G T 15: 12,924,187 (GRCm39) A1190S possibly damaging Het
Dst T C 1: 34,288,886 (GRCm39) V5655A probably benign Het
Etnk1 C G 6: 143,140,953 (GRCm39) probably benign Het
Flnc T A 6: 29,440,499 (GRCm39) V269D probably benign Het
Foxs1 T A 2: 152,775,058 (GRCm39) probably benign Het
Ftsj3 T C 11: 106,141,595 (GRCm39) Y551C possibly damaging Het
Fzd6 A T 15: 38,895,019 (GRCm39) H395L probably damaging Het
Grm6 C T 11: 50,746,537 (GRCm39) A289V possibly damaging Het
Hook1 A G 4: 95,910,468 (GRCm39) D694G probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Igha T C 12: 113,222,611 (GRCm39) E270G Het
Itga2b C A 11: 102,356,288 (GRCm39) probably benign Het
Jade1 A C 3: 41,568,148 (GRCm39) S739R probably benign Het
Lpin3 T C 2: 160,738,674 (GRCm39) S209P probably benign Het
Ly6i A C 15: 74,851,806 (GRCm39) L121R probably damaging Het
Ms4a1 C T 19: 11,232,055 (GRCm39) V107I probably benign Het
Mycbpap T A 11: 94,404,722 (GRCm39) T74S probably benign Het
Nlrp14 A G 7: 106,796,436 (GRCm39) N921D probably benign Het
Nmur1 C T 1: 86,314,103 (GRCm39) E388K probably benign Het
Nol4 T C 18: 23,085,294 (GRCm39) Y40C probably damaging Het
Or1e1c T C 11: 73,266,252 (GRCm39) S229P possibly damaging Het
Or51k1 A T 7: 103,661,367 (GRCm39) C181S probably damaging Het
Or8b51 A T 9: 38,569,621 (GRCm39) Y22* probably null Het
Pawr G A 10: 108,247,861 (GRCm39) V283M possibly damaging Het
Pde6b T C 5: 108,578,503 (GRCm39) Y814H probably benign Het
Pds5b T A 5: 150,724,239 (GRCm39) L1272H probably benign Het
Pkd1l2 T C 8: 117,764,849 (GRCm39) T1350A probably benign Het
Plcz1 T A 6: 139,961,903 (GRCm39) Q216L possibly damaging Het
Prodh A T 16: 17,890,362 (GRCm39) C522S probably null Het
Rasef G T 4: 73,708,960 (GRCm39) P91Q possibly damaging Het
Rgs14 G A 13: 55,531,234 (GRCm39) probably benign Het
Rnase6 A T 14: 51,367,632 (GRCm39) Y8F unknown Het
Rnf216 T A 5: 143,076,180 (GRCm39) T235S probably benign Het
Slco2a1 G A 9: 102,949,834 (GRCm39) probably null Het
Smoc1 A G 12: 81,226,261 (GRCm39) E362G probably damaging Het
Sncaip T C 18: 53,002,169 (GRCm39) L230P probably benign Het
Tdrd3 A G 14: 87,743,597 (GRCm39) E515G possibly damaging Het
Tipin T A 9: 64,195,385 (GRCm39) probably null Het
Tmem9 T A 1: 135,955,145 (GRCm39) V93D possibly damaging Het
Tpm3-rs7 A C 14: 113,552,756 (GRCm39) I217L probably benign Het
Ttc41 A T 10: 86,566,956 (GRCm39) I541F possibly damaging Het
Uck2 T C 1: 167,070,681 (GRCm39) D16G probably benign Het
Vmn1r50 A G 6: 90,085,017 (GRCm39) D254G probably benign Het
Vmn2r50 A C 7: 9,779,974 (GRCm39) F469C probably damaging Het
Vmn2r57 A G 7: 41,049,259 (GRCm39) V830A probably benign Het
Wwc2 T A 8: 48,331,919 (GRCm39) R299S probably benign Het
Xkr9 A T 1: 13,770,990 (GRCm39) M169L probably benign Het
Zbtb10 A G 3: 9,345,807 (GRCm39) D767G probably damaging Het
Zfp106 T C 2: 120,366,077 (GRCm39) Y65C Het
Zfp536 A G 7: 37,268,228 (GRCm39) L396P probably damaging Het
Znhit1 C A 5: 137,011,408 (GRCm39) C135F probably damaging Het
Zscan5b A G 7: 6,241,834 (GRCm39) E351G probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATCACTGAATTTGGGGC -3'
(R):5'- GAGTTGACACATGCGTACTTTTC -3'

Sequencing Primer
(F):5'- GGCTCTGTTTCTCTAGAAAAGGACC -3'
(R):5'- CACATGCGTACTTTTCAGAGCTGAG -3'
Posted On 2021-10-11