Incidental Mutation 'R8986:Fam227b'
ID 684010
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8986 (G1)
Quality Score 224.009
Status Validated
Chromosome 2
Chromosomal Location 125983483-126152004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126116099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 249 (Y249N)
Ref Sequence ENSEMBL: ENSMUSP00000106076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: Y249N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: Y249N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: Y249N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: Y249N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: Y249N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: Y249N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Adamts10 C T 17: 33,543,694 A549V probably benign Het
Akap13 T C 7: 75,609,326 M566T probably benign Het
Alb A G 5: 90,467,366 T246A probably benign Het
Cyfip1 C T 7: 55,908,392 R806C probably damaging Het
Cyp11a1 T A 9: 58,018,361 I195N probably damaging Het
Dclre1a C G 19: 56,538,394 Q863H Het
Ddx19a A G 8: 110,978,556 V311A probably benign Het
Dnajc13 A T 9: 104,180,131 F1557I probably damaging Het
Eml6 T A 11: 29,805,181 T865S possibly damaging Het
Esrrg T A 1: 188,210,907 I382K possibly damaging Het
Fam149a G A 8: 45,358,800 T22M Het
Fanci G A 7: 79,445,724 V1217I probably benign Het
Fermt2 A G 14: 45,504,566 Y108H probably benign Het
Gkn1 A T 6: 87,348,178 V83E probably damaging Het
Glmp T A 3: 88,325,695 S47T probably benign Het
Greb1 T C 12: 16,684,456 H1511R probably damaging Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Htra3 A T 5: 35,679,028 C107S probably damaging Het
Ighv1-58 T C 12: 115,312,215 Q101R probably benign Het
Ighv6-5 A T 12: 114,416,762 L45* probably null Het
Igtp T A 11: 58,206,121 probably null Het
Il1rap T C 16: 26,714,946 S531P probably damaging Het
Kcnd3 A T 3: 105,459,723 H303L probably damaging Het
Kcnj3 G T 2: 55,595,027 S379I probably benign Het
Lrrc36 T C 8: 105,449,461 S156P possibly damaging Het
Mical3 G T 6: 121,014,861 D250E Het
Msh3 T C 13: 92,346,826 T270A probably damaging Het
Myrfl A G 10: 116,822,841 W404R probably damaging Het
Nol7 T C 13: 43,401,509 F206S probably damaging Het
Olfr1148 A T 2: 87,833,311 I91F possibly damaging Het
Olfr705 A G 7: 106,873,843 I134T probably benign Het
Paox A G 7: 140,126,590 E141G probably benign Het
Plod1 A T 4: 147,913,277 H658Q probably damaging Het
Pou4f1 T C 14: 104,466,651 D115G probably damaging Het
Ppp1r26 G T 2: 28,452,790 E811* probably null Het
Qsox1 C T 1: 155,791,083 R220K probably damaging Het
Rabgap1l C T 1: 160,257,535 V781I probably damaging Het
Rad50 T C 11: 53,650,527 D1294G possibly damaging Het
Rbp7 C T 4: 149,452,914 V97I probably benign Het
Rnf219 T C 14: 104,507,982 H86R probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Sdcbp2 T C 2: 151,587,230 V183A probably benign Het
Slfn2 C G 11: 83,069,601 I135M possibly damaging Het
Sntg1 T A 1: 8,414,267 D443V possibly damaging Het
Tas2r105 G A 6: 131,686,950 Q172* probably null Het
Tfdp2 A G 9: 96,290,584 R44G probably damaging Het
Thbd A T 2: 148,406,560 C463S probably damaging Het
Tnxb T C 17: 34,678,672 V807A possibly damaging Het
Trim68 T A 7: 102,678,601 K382* probably null Het
Vmn2r110 T A 17: 20,583,561 I251F probably damaging Het
Vmn2r61 A T 7: 42,265,901 R91* probably null Het
Vmn2r-ps117 G A 17: 18,824,681 W453* probably null Het
Zc3h18 T C 8: 122,407,454 V553A unknown Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp791 A G 8: 85,110,698 F179S probably benign Het
Zyg11a A T 4: 108,184,431 probably null Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
R8417:Fam227b UTSW 2 126121062 missense probably damaging 1.00
R8679:Fam227b UTSW 2 125989008 missense probably benign 0.02
R8731:Fam227b UTSW 2 126126978 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAATGTTTTGGTTGGAGCAAATAC -3'
(R):5'- AAGTGCTACCAGATAGACTCAGTTTG -3'

Sequencing Primer
(F):5'- TTGGTTGGAGCAAATACTCAATC -3'
(R):5'- TTTGCTCATGTTCCTCAATTAGAG -3'
Posted On 2021-10-11