Incidental Mutation 'R8986:Grid1'
ID684051
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8986 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35321707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 340 (D340N)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: D340N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D340N

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Adamts10 C T 17: 33,543,694 A549V probably benign Het
Akap13 T C 7: 75,609,326 M566T probably benign Het
Alb A G 5: 90,467,366 T246A probably benign Het
Cyfip1 C T 7: 55,908,392 R806C probably damaging Het
Cyp11a1 T A 9: 58,018,361 I195N probably damaging Het
Dclre1a C G 19: 56,538,394 Q863H Het
Ddx19a A G 8: 110,978,556 V311A probably benign Het
Dnajc13 A T 9: 104,180,131 F1557I probably damaging Het
Eml6 T A 11: 29,805,181 T865S possibly damaging Het
Esrrg T A 1: 188,210,907 I382K possibly damaging Het
Fam149a G A 8: 45,358,800 T22M Het
Fam227b A T 2: 126,116,099 Y249N probably damaging Het
Fanci G A 7: 79,445,724 V1217I probably benign Het
Fermt2 A G 14: 45,504,566 Y108H probably benign Het
Gkn1 A T 6: 87,348,178 V83E probably damaging Het
Glmp T A 3: 88,325,695 S47T probably benign Het
Greb1 T C 12: 16,684,456 H1511R probably damaging Het
Htra3 A T 5: 35,679,028 C107S probably damaging Het
Ighv1-58 T C 12: 115,312,215 Q101R probably benign Het
Ighv6-5 A T 12: 114,416,762 L45* probably null Het
Igtp T A 11: 58,206,121 probably null Het
Il1rap T C 16: 26,714,946 S531P probably damaging Het
Kcnd3 A T 3: 105,459,723 H303L probably damaging Het
Kcnj3 G T 2: 55,595,027 S379I probably benign Het
Lrrc36 T C 8: 105,449,461 S156P possibly damaging Het
Mical3 G T 6: 121,014,861 D250E Het
Msh3 T C 13: 92,346,826 T270A probably damaging Het
Myrfl A G 10: 116,822,841 W404R probably damaging Het
Nol7 T C 13: 43,401,509 F206S probably damaging Het
Olfr1148 A T 2: 87,833,311 I91F possibly damaging Het
Olfr705 A G 7: 106,873,843 I134T probably benign Het
Paox A G 7: 140,126,590 E141G probably benign Het
Plod1 A T 4: 147,913,277 H658Q probably damaging Het
Pou4f1 T C 14: 104,466,651 D115G probably damaging Het
Ppp1r26 G T 2: 28,452,790 E811* probably null Het
Qsox1 C T 1: 155,791,083 R220K probably damaging Het
Rabgap1l C T 1: 160,257,535 V781I probably damaging Het
Rad50 T C 11: 53,650,527 D1294G possibly damaging Het
Rbp7 C T 4: 149,452,914 V97I probably benign Het
Rnf219 T C 14: 104,507,982 H86R probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Sdcbp2 T C 2: 151,587,230 V183A probably benign Het
Slfn2 C G 11: 83,069,601 I135M possibly damaging Het
Sntg1 T A 1: 8,414,267 D443V possibly damaging Het
Tas2r105 G A 6: 131,686,950 Q172* probably null Het
Tfdp2 A G 9: 96,290,584 R44G probably damaging Het
Thbd A T 2: 148,406,560 C463S probably damaging Het
Tnxb T C 17: 34,678,672 V807A possibly damaging Het
Trim68 T A 7: 102,678,601 K382* probably null Het
Vmn2r110 T A 17: 20,583,561 I251F probably damaging Het
Vmn2r61 A T 7: 42,265,901 R91* probably null Het
Vmn2r-ps117 G A 17: 18,824,681 W453* probably null Het
Zc3h18 T C 8: 122,407,454 V553A unknown Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp791 A G 8: 85,110,698 F179S probably benign Het
Zyg11a A T 4: 108,184,431 probably null Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
R8916:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8934:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8935:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8939:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8993:Grid1 UTSW 14 35026942 missense probably benign 0.00
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATGAGCTGCTGAAAACAAAC -3'
(R):5'- TGTACCAACTAAGTGGGAGTGC -3'

Sequencing Primer
(F):5'- CTCACAGGACCAGGAAGATACTGTTG -3'
(R):5'- CAATAATGAGGGCCTTGTCTCCAG -3'
Posted On2021-10-11