Incidental Mutation 'R8987:Oas1h'
ID 684090
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 068819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121005152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 200 (I200N)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: I200N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: I200N

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171820
AA Change: I200N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168
AA Change: I200N

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T C 5: 113,830,813 (GRCm39) K59R unknown Het
Abcb4 T C 5: 8,977,931 (GRCm39) V503A probably benign Het
Actn4 A G 7: 28,596,398 (GRCm39) V699A probably benign Het
Adam26a T A 8: 44,022,358 (GRCm39) K377N probably benign Het
Adam6b C T 12: 113,454,748 (GRCm39) R522C probably damaging Het
Ahi1 A G 10: 20,839,683 (GRCm39) Y198C probably damaging Het
Ankrd44 G A 1: 54,700,349 (GRCm39) Q720* probably null Het
Arhgap26 A T 18: 39,490,652 (GRCm39) M297L Het
Arhgef11 C T 3: 87,637,788 (GRCm39) T1093I probably damaging Het
Arhgef25 C A 10: 127,018,735 (GRCm39) R609S probably damaging Het
Arhgef28 G T 13: 98,190,472 (GRCm39) H162Q possibly damaging Het
Atg4b A G 1: 93,706,081 (GRCm39) E178G possibly damaging Het
Atxn1l T C 8: 110,459,117 (GRCm39) T382A probably benign Het
Bdp1 A G 13: 100,204,021 (GRCm39) V667A probably benign Het
C6 T C 15: 4,844,344 (GRCm39) I922T Het
Ccdc191 A G 16: 43,751,710 (GRCm39) T347A probably benign Het
Cd22 G T 7: 30,577,172 (GRCm39) P45H probably damaging Het
Cdc45 A G 16: 18,630,300 (GRCm39) F6L probably benign Het
Cenpj T C 14: 56,764,383 (GRCm39) E1343G possibly damaging Het
Chtf8 T A 8: 107,612,735 (GRCm39) N68I probably benign Het
Cldn8 C T 16: 88,359,733 (GRCm39) C64Y probably damaging Het
Cntnap2 G T 6: 46,460,983 (GRCm39) S673I probably benign Het
Cyp3a13 C T 5: 137,909,849 (GRCm39) R158K probably benign Het
Cyp3a57 A T 5: 145,311,039 (GRCm39) probably null Het
Cyp3a57 G T 5: 145,311,040 (GRCm39) probably null Het
D630045J12Rik A G 6: 38,173,898 (GRCm39) I90T probably benign Het
Dapk2 A G 9: 66,157,602 (GRCm39) probably benign Het
Dmxl1 A G 18: 50,026,919 (GRCm39) D2009G Het
Dnah1 C T 14: 31,033,704 (GRCm39) V290I possibly damaging Het
Doc2g A T 19: 4,054,511 (GRCm39) probably null Het
Dpysl2 C T 14: 67,045,402 (GRCm39) G457D probably damaging Het
Drc1 A T 5: 30,521,439 (GRCm39) Y700F probably damaging Het
Ehbp1 A G 11: 22,003,531 (GRCm39) Y1073H probably damaging Het
Epm2aip1 T A 9: 111,101,036 (GRCm39) M3K probably benign Het
Erich3 G A 3: 154,415,340 (GRCm39) R152Q Het
Exoc5 C T 14: 49,252,986 (GRCm39) R609H probably damaging Het
Fam135b T A 15: 71,334,189 (GRCm39) T1002S probably benign Het
Fanca C T 8: 124,024,538 (GRCm39) E528K probably damaging Het
Fsd2 C A 7: 81,209,766 (GRCm39) M25I probably benign Het
Fyco1 T C 9: 123,658,139 (GRCm39) E679G possibly damaging Het
Gas6 T A 8: 13,520,294 (GRCm39) M465L probably damaging Het
Gfra3 A G 18: 34,823,879 (GRCm39) V365A probably benign Het
Gm10269 T G 18: 20,815,981 (GRCm39) K14Q possibly damaging Het
Gm21798 G A 15: 64,689,756 (GRCm39) probably null Het
Gm5916 T A 9: 36,032,286 (GRCm39) R49S probably benign Het
Gpam G T 19: 55,072,227 (GRCm39) T266N possibly damaging Het
Gtse1 A G 15: 85,753,109 (GRCm39) E408G probably benign Het
Hmgcll1 A T 9: 76,037,592 (GRCm39) probably null Het
Hspa12a T A 19: 58,787,903 (GRCm39) R640* probably null Het
Hspa9 T C 18: 35,080,982 (GRCm39) D233G probably damaging Het
Htt T G 5: 34,977,368 (GRCm39) I751M probably benign Het
Hydin T A 8: 111,239,766 (GRCm39) Y2015* probably null Het
Ift43 A C 12: 86,208,275 (GRCm39) M138L probably benign Het
Il11 C T 7: 4,779,029 (GRCm39) V93M probably damaging Het
Iws1 T A 18: 32,226,645 (GRCm39) F741L possibly damaging Het
Jmy A T 13: 93,589,397 (GRCm39) I620N probably damaging Het
Kap T A 6: 133,830,689 (GRCm39) probably benign Het
Kcnk15 A G 2: 163,700,217 (GRCm39) N152S probably damaging Het
Kif16b T C 2: 142,743,278 (GRCm39) K5R probably benign Het
Kif16b C T 2: 142,691,783 (GRCm39) probably null Het
Kirrel1 C T 3: 86,992,400 (GRCm39) R555H probably damaging Het
Krt36 A G 11: 99,994,372 (GRCm39) V235A possibly damaging Het
Lca5 A G 9: 83,283,796 (GRCm39) S246P probably damaging Het
Maml1 T C 11: 50,157,575 (GRCm39) D200G probably damaging Het
Maml3 T C 3: 51,597,868 (GRCm39) R939G probably damaging Het
Mgam A T 6: 40,706,570 (GRCm39) T74S probably damaging Het
Mib2 G T 4: 155,745,351 (GRCm39) D125E probably benign Het
Muc16 A T 9: 18,462,981 (GRCm39) L7407* probably null Het
Mycbp2 A T 14: 103,446,232 (GRCm39) N1865K probably damaging Het
Naip1 A G 13: 100,563,434 (GRCm39) L577S probably damaging Het
Nell1 A T 7: 50,498,399 (GRCm39) D652V probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 (GRCm39) probably benign Het
Or2h2b-ps1 A G 17: 37,480,867 (GRCm39) L122P probably damaging Het
Or2h2b-ps1 A T 17: 37,480,990 (GRCm39) I81N probably damaging Het
Or8g53 A T 9: 39,683,688 (GRCm39) M136K probably benign Het
Otog A T 7: 45,936,878 (GRCm39) Q1529L probably benign Het
Otop1 A T 5: 38,457,071 (GRCm39) I277F probably damaging Het
Pax5 G A 4: 44,645,661 (GRCm39) Q223* probably null Het
Pcdha9 T A 18: 37,132,998 (GRCm39) I689N probably benign Het
Pcsk6 A T 7: 65,576,975 (GRCm39) R138* probably null Het
Pitpnm3 A T 11: 72,003,132 (GRCm39) N59K probably damaging Het
Pla2g4d G A 2: 120,100,442 (GRCm39) T630I probably damaging Het
Plekhg5 T A 4: 152,188,372 (GRCm39) probably benign Het
Plxnb1 T A 9: 108,937,178 (GRCm39) probably benign Het
Prss28 T A 17: 25,528,395 (GRCm39) L6H probably damaging Het
Pyroxd1 T A 6: 142,302,251 (GRCm39) V228E Het
Ripk2 G A 4: 16,123,699 (GRCm39) T492M possibly damaging Het
Satb1 A T 17: 52,112,381 (GRCm39) C78S probably damaging Het
Scaf11 A T 15: 96,316,557 (GRCm39) C1002* probably null Het
Scarf2 A C 16: 17,622,768 (GRCm39) Q499P probably damaging Het
Selenbp1 T A 3: 94,847,425 (GRCm39) M244K probably benign Het
Sik2 T C 9: 50,806,647 (GRCm39) N921S probably benign Het
Slc25a1 A T 16: 17,743,744 (GRCm39) V290E probably damaging Het
Slc28a3 C T 13: 58,719,254 (GRCm39) probably benign Het
Slc35b4 A T 6: 34,137,442 (GRCm39) D213E probably benign Het
Slc40a1 A C 1: 45,950,495 (GRCm39) M319R probably damaging Het
Slc8a1 A T 17: 81,955,282 (GRCm39) F585L possibly damaging Het
Slco3a1 T A 7: 73,970,324 (GRCm39) N428Y possibly damaging Het
Slfn2 G A 11: 82,960,363 (GRCm39) C114Y probably damaging Het
Smg5 T C 3: 88,267,714 (GRCm39) probably null Het
Spata13 T A 14: 60,993,896 (GRCm39) L1116Q possibly damaging Het
Spmap1 C T 11: 97,666,510 (GRCm39) V59M probably damaging Het
Syne1 A G 10: 5,177,579 (GRCm39) V4965A possibly damaging Het
Tacc3 G T 5: 33,826,169 (GRCm39) V472F possibly damaging Het
Tacr3 T A 3: 134,560,573 (GRCm39) Y171N probably damaging Het
Tacr3 T G 3: 134,560,718 (GRCm39) L219R probably damaging Het
Tbx3 C A 5: 119,818,886 (GRCm39) A507E possibly damaging Het
Telo2 A T 17: 25,324,402 (GRCm39) D494E probably damaging Het
Tfip11 T C 5: 112,484,921 (GRCm39) F744S possibly damaging Het
Tgm3 A C 2: 129,880,403 (GRCm39) N403T probably benign Het
Thoc3 A T 13: 54,615,708 (GRCm39) S119T possibly damaging Het
Tmem176b A T 6: 48,812,530 (GRCm39) I145N probably damaging Het
Trio T A 15: 27,732,773 (GRCm39) Q3036L probably benign Het
Trpc4 T C 3: 54,102,132 (GRCm39) V10A probably benign Het
Trpm3 A G 19: 22,896,124 (GRCm39) Y987C probably damaging Het
Tspoap1 A G 11: 87,654,394 (GRCm39) K225E probably damaging Het
Txnrd3 A T 6: 89,638,477 (GRCm39) Q222L possibly damaging Het
Usp34 A T 11: 23,414,267 (GRCm39) M2756L Het
Vmn2r81 C T 10: 79,129,704 (GRCm39) T865I probably damaging Het
Vnn1 A G 10: 23,776,714 (GRCm39) Y355C probably damaging Het
Wipf2 A T 11: 98,783,092 (GRCm39) S173C probably damaging Het
Wnt1 A T 15: 98,689,624 (GRCm39) H137L probably damaging Het
Xylt2 A T 11: 94,561,278 (GRCm39) C162S probably damaging Het
Zfp426 T C 9: 20,387,744 (GRCm39) E33G probably damaging Het
Zfp811 A C 17: 33,017,801 (GRCm39) C80G possibly damaging Het
Zfp931 T C 2: 177,709,591 (GRCm39) H265R probably damaging Het
Zfp931 G A 2: 177,709,592 (GRCm39) H265Y probably damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCGGACAAAGTTTTCCCTG -3'
(R):5'- ACAGCCAGCTATAATAGACCTCTTC -3'

Sequencing Primer
(F):5'- GTGACTGTGACCCTATAGAGC -3'
(R):5'- AGCTATAATAGACCTCTTCTCTGGC -3'
Posted On 2021-10-11