Incidental Mutation 'R8987:Mgam'
ID 684096
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40729636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 74 (T74S)
Ref Sequence ENSEMBL: ENSMUSP00000144627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: T74S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: T74S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C T 11: 97,775,684 V59M probably damaging Het
1700069L16Rik T C 5: 113,692,752 K59R unknown Het
Abcb4 T C 5: 8,927,931 V503A probably benign Het
Actn4 A G 7: 28,896,973 V699A probably benign Het
Adam26a T A 8: 43,569,321 K377N probably benign Het
Adam6b C T 12: 113,491,128 R522C probably damaging Het
Ahi1 A G 10: 20,963,784 Y198C probably damaging Het
Ankrd44 G A 1: 54,661,190 Q720* probably null Het
Arhgap26 A T 18: 39,357,599 M297L Het
Arhgef11 C T 3: 87,730,481 T1093I probably damaging Het
Arhgef25 C A 10: 127,182,866 R609S probably damaging Het
Arhgef28 G T 13: 98,053,964 H162Q possibly damaging Het
Atg4b A G 1: 93,778,359 E178G possibly damaging Het
Atxn1l T C 8: 109,732,485 T382A probably benign Het
Bdp1 A G 13: 100,067,513 V667A probably benign Het
C6 T C 15: 4,814,862 I922T Het
Ccdc191 A G 16: 43,931,347 T347A probably benign Het
Cd22 G T 7: 30,877,747 P45H probably damaging Het
Cdc45 A G 16: 18,811,550 F6L probably benign Het
Cenpj T C 14: 56,526,926 E1343G possibly damaging Het
Chtf8 T A 8: 106,886,103 N68I probably benign Het
Cldn8 C T 16: 88,562,845 C64Y probably damaging Het
Cntnap2 G T 6: 46,484,049 S673I probably benign Het
Cyp3a13 C T 5: 137,911,587 R158K probably benign Het
Cyp3a57 A T 5: 145,374,229 probably null Het
Cyp3a57 G T 5: 145,374,230 probably null Het
D630045J12Rik A G 6: 38,196,963 I90T probably benign Het
Dapk2 A G 9: 66,250,320 probably benign Het
Dmxl1 A G 18: 49,893,852 D2009G Het
Dnah1 C T 14: 31,311,747 V290I possibly damaging Het
Doc2g A T 19: 4,004,511 probably null Het
Dpysl2 C T 14: 66,807,953 G457D probably damaging Het
Drc1 A T 5: 30,364,095 Y700F probably damaging Het
Ehbp1 A G 11: 22,053,531 Y1073H probably damaging Het
Epm2aip1 T A 9: 111,271,968 M3K probably benign Het
Erich3 G A 3: 154,709,703 R152Q Het
Exoc5 C T 14: 49,015,529 R609H probably damaging Het
Fam135b T A 15: 71,462,340 T1002S probably benign Het
Fanca C T 8: 123,297,799 E528K probably damaging Het
Fsd2 C A 7: 81,560,018 M25I probably benign Het
Fyco1 T C 9: 123,829,074 E679G possibly damaging Het
Gas6 T A 8: 13,470,294 M465L probably damaging Het
Gfra3 A G 18: 34,690,826 V365A probably benign Het
Gm10269 T G 18: 20,682,924 K14Q possibly damaging Het
Gm21798 G A 15: 64,817,907 probably null Het
Gm5916 T A 9: 36,120,990 R49S probably benign Het
Gpam G T 19: 55,083,795 T266N possibly damaging Het
Gtse1 A G 15: 85,868,908 E408G probably benign Het
Hmgcll1 A T 9: 76,130,310 probably null Het
Hspa12a T A 19: 58,799,471 R640* probably null Het
Hspa9 T C 18: 34,947,929 D233G probably damaging Het
Htt T G 5: 34,820,024 I751M probably benign Het
Hydin T A 8: 110,513,134 Y2015* probably null Het
Ift43 A C 12: 86,161,501 M138L probably benign Het
Il11 C T 7: 4,776,030 V93M probably damaging Het
Iws1 T A 18: 32,093,592 F741L possibly damaging Het
Jmy A T 13: 93,452,889 I620N probably damaging Het
Kap T A 6: 133,853,726 probably benign Het
Kcnk15 A G 2: 163,858,297 N152S probably damaging Het
Kif16b C T 2: 142,849,863 probably null Het
Kif16b T C 2: 142,901,358 K5R probably benign Het
Kirrel C T 3: 87,085,093 R555H probably damaging Het
Krt36 A G 11: 100,103,546 V235A possibly damaging Het
Lca5 A G 9: 83,401,743 S246P probably damaging Het
Maml1 T C 11: 50,266,748 D200G probably damaging Het
Maml3 T C 3: 51,690,447 R939G probably damaging Het
Mib2 G T 4: 155,660,894 D125E probably benign Het
Muc16 A T 9: 18,551,685 L7407* probably null Het
Mycbp2 A T 14: 103,208,796 N1865K probably damaging Het
Naip1 A G 13: 100,426,926 L577S probably damaging Het
Nell1 A T 7: 50,848,651 D652V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 probably benign Het
Oas1h T A 5: 120,867,089 I200N probably damaging Het
Olfr753-ps1 A G 17: 37,169,976 L122P probably damaging Het
Olfr753-ps1 A T 17: 37,170,099 I81N probably damaging Het
Olfr968 A T 9: 39,772,392 M136K probably benign Het
Otog A T 7: 46,287,454 Q1529L probably benign Het
Otop1 A T 5: 38,299,727 I277F probably damaging Het
Pax5 G A 4: 44,645,661 Q223* probably null Het
Pcdha9 T A 18: 36,999,945 I689N probably benign Het
Pcsk6 A T 7: 65,927,227 R138* probably null Het
Pitpnm3 A T 11: 72,112,306 N59K probably damaging Het
Pla2g4d G A 2: 120,269,961 T630I probably damaging Het
Plekhg5 T A 4: 152,103,915 probably benign Het
Plxnb1 T A 9: 109,108,110 probably benign Het
Prss28 T A 17: 25,309,421 L6H probably damaging Het
Pyroxd1 T A 6: 142,356,525 V228E Het
Ripk2 G A 4: 16,123,699 T492M possibly damaging Het
Satb1 A T 17: 51,805,353 C78S probably damaging Het
Scaf11 A T 15: 96,418,676 C1002* probably null Het
Scarf2 A C 16: 17,804,904 Q499P probably damaging Het
Selenbp1 T A 3: 94,940,114 M244K probably benign Het
Sik2 T C 9: 50,895,347 N921S probably benign Het
Slc25a1 A T 16: 17,925,880 V290E probably damaging Het
Slc28a3 C T 13: 58,571,440 probably benign Het
Slc35b4 A T 6: 34,160,507 D213E probably benign Het
Slc40a1 A C 1: 45,911,335 M319R probably damaging Het
Slc8a1 A T 17: 81,647,853 F585L possibly damaging Het
Slco3a1 T A 7: 74,320,576 N428Y possibly damaging Het
Slfn2 G A 11: 83,069,537 C114Y probably damaging Het
Smg5 T C 3: 88,360,407 probably null Het
Spata13 T A 14: 60,756,447 L1116Q possibly damaging Het
Syne1 A G 10: 5,227,579 V4965A possibly damaging Het
Tacc3 G T 5: 33,668,825 V472F possibly damaging Het
Tacr3 T A 3: 134,854,812 Y171N probably damaging Het
Tacr3 T G 3: 134,854,957 L219R probably damaging Het
Tbx3 C A 5: 119,680,821 A507E possibly damaging Het
Telo2 A T 17: 25,105,428 D494E probably damaging Het
Tfip11 T C 5: 112,337,055 F744S possibly damaging Het
Tgm3 A C 2: 130,038,483 N403T probably benign Het
Thoc3 A T 13: 54,467,895 S119T possibly damaging Het
Tmem176b A T 6: 48,835,596 I145N probably damaging Het
Trio T A 15: 27,732,687 Q3036L probably benign Het
Trpc4 T C 3: 54,194,711 V10A probably benign Het
Trpm3 A G 19: 22,918,760 Y987C probably damaging Het
Tspoap1 A G 11: 87,763,568 K225E probably damaging Het
Txnrd3 A T 6: 89,661,495 Q222L possibly damaging Het
Usp34 A T 11: 23,464,267 M2756L Het
Vmn2r81 C T 10: 79,293,870 T865I probably damaging Het
Vnn1 A G 10: 23,900,816 Y355C probably damaging Het
Wipf2 A T 11: 98,892,266 S173C probably damaging Het
Wnt1 A T 15: 98,791,743 H137L probably damaging Het
Xylt2 A T 11: 94,670,452 C162S probably damaging Het
Zfp426 T C 9: 20,476,448 E33G probably damaging Het
Zfp811 A C 17: 32,798,827 C80G possibly damaging Het
Zfp931 T C 2: 178,067,798 H265R probably damaging Het
Zfp931 G A 2: 178,067,799 H265Y probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGCTGATGTTTCCCAGTCC -3'
(R):5'- GACCCACCAGGACATTACTG -3'

Sequencing Primer
(F):5'- TCCATTACAAATAATCTAGGGGTCCC -3'
(R):5'- TGACAAAAGAGAGTCACAGCTTC -3'
Posted On 2021-10-11