Mutagenetix > Incidental Mutation

Incidental Mutation 'R8987:Cntnap2'

684097

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

068819-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 46484049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 673 (S673I)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: S673I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S673I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

96% (123/128)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 128 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	C	T	11: 97,775,684	V59M	probably damaging	Het
1700069L16Rik	T	C	5: 113,692,752	K59R	unknown	Het
Abcb4	T	C	5: 8,927,931	V503A	probably benign	Het
Actn4	A	G	7: 28,896,973	V699A	probably benign	Het
Adam26a	T	A	8: 43,569,321	K377N	probably benign	Het
Adam6b	C	T	12: 113,491,128	R522C	probably damaging	Het
Ahi1	A	G	10: 20,963,784	Y198C	probably damaging	Het
Ankrd44	G	A	1: 54,661,190	Q720*	probably null	Het
Arhgap26	A	T	18: 39,357,599	M297L		Het
Arhgef11	C	T	3: 87,730,481	T1093I	probably damaging	Het
Arhgef25	C	A	10: 127,182,866	R609S	probably damaging	Het
Arhgef28	G	T	13: 98,053,964	H162Q	possibly damaging	Het
Atg4b	A	G	1: 93,778,359	E178G	possibly damaging	Het
Atxn1l	T	C	8: 109,732,485	T382A	probably benign	Het
Bdp1	A	G	13: 100,067,513	V667A	probably benign	Het
C6	T	C	15: 4,814,862	I922T		Het
Ccdc191	A	G	16: 43,931,347	T347A	probably benign	Het
Cd22	G	T	7: 30,877,747	P45H	probably damaging	Het
Cdc45	A	G	16: 18,811,550	F6L	probably benign	Het
Cenpj	T	C	14: 56,526,926	E1343G	possibly damaging	Het
Chtf8	T	A	8: 106,886,103	N68I	probably benign	Het
Cldn8	C	T	16: 88,562,845	C64Y	probably damaging	Het
Cyp3a13	C	T	5: 137,911,587	R158K	probably benign	Het
Cyp3a57	A	T	5: 145,374,229		probably null	Het
Cyp3a57	G	T	5: 145,374,230		probably null	Het
D630045J12Rik	A	G	6: 38,196,963	I90T	probably benign	Het
Dapk2	A	G	9: 66,250,320		probably benign	Het
Dmxl1	A	G	18: 49,893,852	D2009G		Het
Dnah1	C	T	14: 31,311,747	V290I	possibly damaging	Het
Doc2g	A	T	19: 4,004,511		probably null	Het
Dpysl2	C	T	14: 66,807,953	G457D	probably damaging	Het
Drc1	A	T	5: 30,364,095	Y700F	probably damaging	Het
Ehbp1	A	G	11: 22,053,531	Y1073H	probably damaging	Het
Epm2aip1	T	A	9: 111,271,968	M3K	probably benign	Het
Erich3	G	A	3: 154,709,703	R152Q		Het
Exoc5	C	T	14: 49,015,529	R609H	probably damaging	Het
Fam135b	T	A	15: 71,462,340	T1002S	probably benign	Het
Fanca	C	T	8: 123,297,799	E528K	probably damaging	Het
Fsd2	C	A	7: 81,560,018	M25I	probably benign	Het
Fyco1	T	C	9: 123,829,074	E679G	possibly damaging	Het
Gas6	T	A	8: 13,470,294	M465L	probably damaging	Het
Gfra3	A	G	18: 34,690,826	V365A	probably benign	Het
Gm10269	T	G	18: 20,682,924	K14Q	possibly damaging	Het
Gm21798	G	A	15: 64,817,907		probably null	Het
Gm5916	T	A	9: 36,120,990	R49S	probably benign	Het
Gpam	G	T	19: 55,083,795	T266N	possibly damaging	Het
Gtse1	A	G	15: 85,868,908	E408G	probably benign	Het
Hmgcll1	A	T	9: 76,130,310		probably null	Het
Hspa12a	T	A	19: 58,799,471	R640*	probably null	Het
Hspa9	T	C	18: 34,947,929	D233G	probably damaging	Het
Htt	T	G	5: 34,820,024	I751M	probably benign	Het
Hydin	T	A	8: 110,513,134	Y2015*	probably null	Het
Ift43	A	C	12: 86,161,501	M138L	probably benign	Het
Il11	C	T	7: 4,776,030	V93M	probably damaging	Het
Iws1	T	A	18: 32,093,592	F741L	possibly damaging	Het
Jmy	A	T	13: 93,452,889	I620N	probably damaging	Het
Kap	T	A	6: 133,853,726		probably benign	Het
Kcnk15	A	G	2: 163,858,297	N152S	probably damaging	Het
Kif16b	C	T	2: 142,849,863		probably null	Het
Kif16b	T	C	2: 142,901,358	K5R	probably benign	Het
Kirrel	C	T	3: 87,085,093	R555H	probably damaging	Het
Krt36	A	G	11: 100,103,546	V235A	possibly damaging	Het
Lca5	A	G	9: 83,401,743	S246P	probably damaging	Het
Maml1	T	C	11: 50,266,748	D200G	probably damaging	Het
Maml3	T	C	3: 51,690,447	R939G	probably damaging	Het
Mgam	A	T	6: 40,729,636	T74S	probably damaging	Het
Mib2	G	T	4: 155,660,894	D125E	probably benign	Het
Muc16	A	T	9: 18,551,685	L7407*	probably null	Het
Mycbp2	A	T	14: 103,208,796	N1865K	probably damaging	Het
Naip1	A	G	13: 100,426,926	L577S	probably damaging	Het
Nell1	A	T	7: 50,848,651	D652V	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nxph1	G	A	6: 8,950,312		probably benign	Het
Oas1h	T	A	5: 120,867,089	I200N	probably damaging	Het
Olfr753-ps1	A	G	17: 37,169,976	L122P	probably damaging	Het
Olfr753-ps1	A	T	17: 37,170,099	I81N	probably damaging	Het
Olfr968	A	T	9: 39,772,392	M136K	probably benign	Het
Otog	A	T	7: 46,287,454	Q1529L	probably benign	Het
Otop1	A	T	5: 38,299,727	I277F	probably damaging	Het
Pax5	G	A	4: 44,645,661	Q223*	probably null	Het
Pcdha9	T	A	18: 36,999,945	I689N	probably benign	Het
Pcsk6	A	T	7: 65,927,227	R138*	probably null	Het
Pitpnm3	A	T	11: 72,112,306	N59K	probably damaging	Het
Pla2g4d	G	A	2: 120,269,961	T630I	probably damaging	Het
Plekhg5	T	A	4: 152,103,915		probably benign	Het
Plxnb1	T	A	9: 109,108,110		probably benign	Het
Prss28	T	A	17: 25,309,421	L6H	probably damaging	Het
Pyroxd1	T	A	6: 142,356,525	V228E		Het
Ripk2	G	A	4: 16,123,699	T492M	possibly damaging	Het
Satb1	A	T	17: 51,805,353	C78S	probably damaging	Het
Scaf11	A	T	15: 96,418,676	C1002*	probably null	Het
Scarf2	A	C	16: 17,804,904	Q499P	probably damaging	Het
Selenbp1	T	A	3: 94,940,114	M244K	probably benign	Het
Sik2	T	C	9: 50,895,347	N921S	probably benign	Het
Slc25a1	A	T	16: 17,925,880	V290E	probably damaging	Het
Slc28a3	C	T	13: 58,571,440		probably benign	Het
Slc35b4	A	T	6: 34,160,507	D213E	probably benign	Het
Slc40a1	A	C	1: 45,911,335	M319R	probably damaging	Het
Slc8a1	A	T	17: 81,647,853	F585L	possibly damaging	Het
Slco3a1	T	A	7: 74,320,576	N428Y	possibly damaging	Het
Slfn2	G	A	11: 83,069,537	C114Y	probably damaging	Het
Smg5	T	C	3: 88,360,407		probably null	Het
Spata13	T	A	14: 60,756,447	L1116Q	possibly damaging	Het
Syne1	A	G	10: 5,227,579	V4965A	possibly damaging	Het
Tacc3	G	T	5: 33,668,825	V472F	possibly damaging	Het
Tacr3	T	A	3: 134,854,812	Y171N	probably damaging	Het
Tacr3	T	G	3: 134,854,957	L219R	probably damaging	Het
Tbx3	C	A	5: 119,680,821	A507E	possibly damaging	Het
Telo2	A	T	17: 25,105,428	D494E	probably damaging	Het
Tfip11	T	C	5: 112,337,055	F744S	possibly damaging	Het
Tgm3	A	C	2: 130,038,483	N403T	probably benign	Het
Thoc3	A	T	13: 54,467,895	S119T	possibly damaging	Het
Tmem176b	A	T	6: 48,835,596	I145N	probably damaging	Het
Trio	T	A	15: 27,732,687	Q3036L	probably benign	Het
Trpc4	T	C	3: 54,194,711	V10A	probably benign	Het
Trpm3	A	G	19: 22,918,760	Y987C	probably damaging	Het
Tspoap1	A	G	11: 87,763,568	K225E	probably damaging	Het
Txnrd3	A	T	6: 89,661,495	Q222L	possibly damaging	Het
Usp34	A	T	11: 23,464,267	M2756L		Het
Vmn2r81	C	T	10: 79,293,870	T865I	probably damaging	Het
Vnn1	A	G	10: 23,900,816	Y355C	probably damaging	Het
Wipf2	A	T	11: 98,892,266	S173C	probably damaging	Het
Wnt1	A	T	15: 98,791,743	H137L	probably damaging	Het
Xylt2	A	T	11: 94,670,452	C162S	probably damaging	Het
Zfp426	T	C	9: 20,476,448	E33G	probably damaging	Het
Zfp811	A	C	17: 32,798,827	C80G	possibly damaging	Het
Zfp931	T	C	2: 178,067,798	H265R	probably damaging	Het
Zfp931	G	A	2: 178,067,799	H265Y	probably damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GACATTTGAAGCAGCACTGG -3'
(R):5'- GACTTATTTACAGCCATCTGCAC -3'

Sequencing Primer
(F):5'- CTGGAGTACTAACGAGTCACTGTC -3'
(R):5'- TTACAGCCATCTGCACATTGAGG -3'

Posted On

2021-10-11