Incidental Mutation 'R8987:Hydin'
ID 684113
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms 1700034M11Rik, 4930545D19Rik, hy3, hyrh, hy-3
MMRRC Submission 068819-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.744) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110993609-111336885 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111239766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 2015 (Y2015*)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000043141
AA Change: Y2015*
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: Y2015*

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T C 5: 113,830,813 (GRCm39) K59R unknown Het
Abcb4 T C 5: 8,977,931 (GRCm39) V503A probably benign Het
Actn4 A G 7: 28,596,398 (GRCm39) V699A probably benign Het
Adam26a T A 8: 44,022,358 (GRCm39) K377N probably benign Het
Adam6b C T 12: 113,454,748 (GRCm39) R522C probably damaging Het
Ahi1 A G 10: 20,839,683 (GRCm39) Y198C probably damaging Het
Ankrd44 G A 1: 54,700,349 (GRCm39) Q720* probably null Het
Arhgap26 A T 18: 39,490,652 (GRCm39) M297L Het
Arhgef11 C T 3: 87,637,788 (GRCm39) T1093I probably damaging Het
Arhgef25 C A 10: 127,018,735 (GRCm39) R609S probably damaging Het
Arhgef28 G T 13: 98,190,472 (GRCm39) H162Q possibly damaging Het
Atg4b A G 1: 93,706,081 (GRCm39) E178G possibly damaging Het
Atxn1l T C 8: 110,459,117 (GRCm39) T382A probably benign Het
Bdp1 A G 13: 100,204,021 (GRCm39) V667A probably benign Het
C6 T C 15: 4,844,344 (GRCm39) I922T Het
Ccdc191 A G 16: 43,751,710 (GRCm39) T347A probably benign Het
Cd22 G T 7: 30,577,172 (GRCm39) P45H probably damaging Het
Cdc45 A G 16: 18,630,300 (GRCm39) F6L probably benign Het
Cenpj T C 14: 56,764,383 (GRCm39) E1343G possibly damaging Het
Chtf8 T A 8: 107,612,735 (GRCm39) N68I probably benign Het
Cldn8 C T 16: 88,359,733 (GRCm39) C64Y probably damaging Het
Cntnap2 G T 6: 46,460,983 (GRCm39) S673I probably benign Het
Cyp3a13 C T 5: 137,909,849 (GRCm39) R158K probably benign Het
Cyp3a57 A T 5: 145,311,039 (GRCm39) probably null Het
Cyp3a57 G T 5: 145,311,040 (GRCm39) probably null Het
D630045J12Rik A G 6: 38,173,898 (GRCm39) I90T probably benign Het
Dapk2 A G 9: 66,157,602 (GRCm39) probably benign Het
Dmxl1 A G 18: 50,026,919 (GRCm39) D2009G Het
Dnah1 C T 14: 31,033,704 (GRCm39) V290I possibly damaging Het
Doc2g A T 19: 4,054,511 (GRCm39) probably null Het
Dpysl2 C T 14: 67,045,402 (GRCm39) G457D probably damaging Het
Drc1 A T 5: 30,521,439 (GRCm39) Y700F probably damaging Het
Ehbp1 A G 11: 22,003,531 (GRCm39) Y1073H probably damaging Het
Epm2aip1 T A 9: 111,101,036 (GRCm39) M3K probably benign Het
Erich3 G A 3: 154,415,340 (GRCm39) R152Q Het
Exoc5 C T 14: 49,252,986 (GRCm39) R609H probably damaging Het
Fam135b T A 15: 71,334,189 (GRCm39) T1002S probably benign Het
Fanca C T 8: 124,024,538 (GRCm39) E528K probably damaging Het
Fsd2 C A 7: 81,209,766 (GRCm39) M25I probably benign Het
Fyco1 T C 9: 123,658,139 (GRCm39) E679G possibly damaging Het
Gas6 T A 8: 13,520,294 (GRCm39) M465L probably damaging Het
Gfra3 A G 18: 34,823,879 (GRCm39) V365A probably benign Het
Gm10269 T G 18: 20,815,981 (GRCm39) K14Q possibly damaging Het
Gm21798 G A 15: 64,689,756 (GRCm39) probably null Het
Gm5916 T A 9: 36,032,286 (GRCm39) R49S probably benign Het
Gpam G T 19: 55,072,227 (GRCm39) T266N possibly damaging Het
Gtse1 A G 15: 85,753,109 (GRCm39) E408G probably benign Het
Hmgcll1 A T 9: 76,037,592 (GRCm39) probably null Het
Hspa12a T A 19: 58,787,903 (GRCm39) R640* probably null Het
Hspa9 T C 18: 35,080,982 (GRCm39) D233G probably damaging Het
Htt T G 5: 34,977,368 (GRCm39) I751M probably benign Het
Ift43 A C 12: 86,208,275 (GRCm39) M138L probably benign Het
Il11 C T 7: 4,779,029 (GRCm39) V93M probably damaging Het
Iws1 T A 18: 32,226,645 (GRCm39) F741L possibly damaging Het
Jmy A T 13: 93,589,397 (GRCm39) I620N probably damaging Het
Kap T A 6: 133,830,689 (GRCm39) probably benign Het
Kcnk15 A G 2: 163,700,217 (GRCm39) N152S probably damaging Het
Kif16b C T 2: 142,691,783 (GRCm39) probably null Het
Kif16b T C 2: 142,743,278 (GRCm39) K5R probably benign Het
Kirrel1 C T 3: 86,992,400 (GRCm39) R555H probably damaging Het
Krt36 A G 11: 99,994,372 (GRCm39) V235A possibly damaging Het
Lca5 A G 9: 83,283,796 (GRCm39) S246P probably damaging Het
Maml1 T C 11: 50,157,575 (GRCm39) D200G probably damaging Het
Maml3 T C 3: 51,597,868 (GRCm39) R939G probably damaging Het
Mgam A T 6: 40,706,570 (GRCm39) T74S probably damaging Het
Mib2 G T 4: 155,745,351 (GRCm39) D125E probably benign Het
Muc16 A T 9: 18,462,981 (GRCm39) L7407* probably null Het
Mycbp2 A T 14: 103,446,232 (GRCm39) N1865K probably damaging Het
Naip1 A G 13: 100,563,434 (GRCm39) L577S probably damaging Het
Nell1 A T 7: 50,498,399 (GRCm39) D652V probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 (GRCm39) probably benign Het
Oas1h T A 5: 121,005,152 (GRCm39) I200N probably damaging Het
Or2h2b-ps1 A G 17: 37,480,867 (GRCm39) L122P probably damaging Het
Or2h2b-ps1 A T 17: 37,480,990 (GRCm39) I81N probably damaging Het
Or8g53 A T 9: 39,683,688 (GRCm39) M136K probably benign Het
Otog A T 7: 45,936,878 (GRCm39) Q1529L probably benign Het
Otop1 A T 5: 38,457,071 (GRCm39) I277F probably damaging Het
Pax5 G A 4: 44,645,661 (GRCm39) Q223* probably null Het
Pcdha9 T A 18: 37,132,998 (GRCm39) I689N probably benign Het
Pcsk6 A T 7: 65,576,975 (GRCm39) R138* probably null Het
Pitpnm3 A T 11: 72,003,132 (GRCm39) N59K probably damaging Het
Pla2g4d G A 2: 120,100,442 (GRCm39) T630I probably damaging Het
Plekhg5 T A 4: 152,188,372 (GRCm39) probably benign Het
Plxnb1 T A 9: 108,937,178 (GRCm39) probably benign Het
Prss28 T A 17: 25,528,395 (GRCm39) L6H probably damaging Het
Pyroxd1 T A 6: 142,302,251 (GRCm39) V228E Het
Ripk2 G A 4: 16,123,699 (GRCm39) T492M possibly damaging Het
Satb1 A T 17: 52,112,381 (GRCm39) C78S probably damaging Het
Scaf11 A T 15: 96,316,557 (GRCm39) C1002* probably null Het
Scarf2 A C 16: 17,622,768 (GRCm39) Q499P probably damaging Het
Selenbp1 T A 3: 94,847,425 (GRCm39) M244K probably benign Het
Sik2 T C 9: 50,806,647 (GRCm39) N921S probably benign Het
Slc25a1 A T 16: 17,743,744 (GRCm39) V290E probably damaging Het
Slc28a3 C T 13: 58,719,254 (GRCm39) probably benign Het
Slc35b4 A T 6: 34,137,442 (GRCm39) D213E probably benign Het
Slc40a1 A C 1: 45,950,495 (GRCm39) M319R probably damaging Het
Slc8a1 A T 17: 81,955,282 (GRCm39) F585L possibly damaging Het
Slco3a1 T A 7: 73,970,324 (GRCm39) N428Y possibly damaging Het
Slfn2 G A 11: 82,960,363 (GRCm39) C114Y probably damaging Het
Smg5 T C 3: 88,267,714 (GRCm39) probably null Het
Spata13 T A 14: 60,993,896 (GRCm39) L1116Q possibly damaging Het
Spmap1 C T 11: 97,666,510 (GRCm39) V59M probably damaging Het
Syne1 A G 10: 5,177,579 (GRCm39) V4965A possibly damaging Het
Tacc3 G T 5: 33,826,169 (GRCm39) V472F possibly damaging Het
Tacr3 T A 3: 134,560,573 (GRCm39) Y171N probably damaging Het
Tacr3 T G 3: 134,560,718 (GRCm39) L219R probably damaging Het
Tbx3 C A 5: 119,818,886 (GRCm39) A507E possibly damaging Het
Telo2 A T 17: 25,324,402 (GRCm39) D494E probably damaging Het
Tfip11 T C 5: 112,484,921 (GRCm39) F744S possibly damaging Het
Tgm3 A C 2: 129,880,403 (GRCm39) N403T probably benign Het
Thoc3 A T 13: 54,615,708 (GRCm39) S119T possibly damaging Het
Tmem176b A T 6: 48,812,530 (GRCm39) I145N probably damaging Het
Trio T A 15: 27,732,773 (GRCm39) Q3036L probably benign Het
Trpc4 T C 3: 54,102,132 (GRCm39) V10A probably benign Het
Trpm3 A G 19: 22,896,124 (GRCm39) Y987C probably damaging Het
Tspoap1 A G 11: 87,654,394 (GRCm39) K225E probably damaging Het
Txnrd3 A T 6: 89,638,477 (GRCm39) Q222L possibly damaging Het
Usp34 A T 11: 23,414,267 (GRCm39) M2756L Het
Vmn2r81 C T 10: 79,129,704 (GRCm39) T865I probably damaging Het
Vnn1 A G 10: 23,776,714 (GRCm39) Y355C probably damaging Het
Wipf2 A T 11: 98,783,092 (GRCm39) S173C probably damaging Het
Wnt1 A T 15: 98,689,624 (GRCm39) H137L probably damaging Het
Xylt2 A T 11: 94,561,278 (GRCm39) C162S probably damaging Het
Zfp426 T C 9: 20,387,744 (GRCm39) E33G probably damaging Het
Zfp811 A C 17: 33,017,801 (GRCm39) C80G possibly damaging Het
Zfp931 T C 2: 177,709,591 (GRCm39) H265R probably damaging Het
Zfp931 G A 2: 177,709,592 (GRCm39) H265Y probably damaging Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 111,296,434 (GRCm39) missense possibly damaging 0.69
IGL00432:Hydin APN 8 111,327,884 (GRCm39) missense probably damaging 0.98
IGL01025:Hydin APN 8 111,053,033 (GRCm39) missense probably benign 0.38
IGL01140:Hydin APN 8 111,124,694 (GRCm39) missense probably benign 0.14
IGL01317:Hydin APN 8 111,053,078 (GRCm39) missense probably damaging 0.98
IGL01473:Hydin APN 8 111,038,792 (GRCm39) missense probably benign 0.08
IGL01473:Hydin APN 8 111,081,585 (GRCm39) missense probably damaging 1.00
IGL01610:Hydin APN 8 111,284,345 (GRCm39) missense probably benign 0.00
IGL01685:Hydin APN 8 111,081,665 (GRCm39) nonsense probably null
IGL01734:Hydin APN 8 111,217,421 (GRCm39) nonsense probably null
IGL01743:Hydin APN 8 111,319,408 (GRCm39) missense possibly damaging 0.94
IGL01829:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL01919:Hydin APN 8 111,245,806 (GRCm39) missense possibly damaging 0.89
IGL01946:Hydin APN 8 111,217,350 (GRCm39) missense possibly damaging 0.91
IGL01983:Hydin APN 8 111,241,527 (GRCm39) missense probably benign 0.02
IGL02122:Hydin APN 8 111,221,047 (GRCm39) missense possibly damaging 0.86
IGL02140:Hydin APN 8 111,293,570 (GRCm39) missense probably benign
IGL02158:Hydin APN 8 111,336,598 (GRCm39) missense possibly damaging 0.89
IGL02167:Hydin APN 8 111,145,055 (GRCm39) missense possibly damaging 0.96
IGL02171:Hydin APN 8 111,178,590 (GRCm39) nonsense probably null
IGL02185:Hydin APN 8 111,233,108 (GRCm39) missense possibly damaging 0.86
IGL02517:Hydin APN 8 111,293,604 (GRCm39) missense probably benign 0.01
IGL02639:Hydin APN 8 111,265,081 (GRCm39) missense probably benign 0.01
IGL02644:Hydin APN 8 111,265,100 (GRCm39) missense probably damaging 1.00
IGL02652:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL02658:Hydin APN 8 111,139,908 (GRCm39) missense possibly damaging 0.86
IGL02706:Hydin APN 8 111,137,198 (GRCm39) missense probably damaging 0.99
IGL02892:Hydin APN 8 111,325,591 (GRCm39) missense possibly damaging 0.89
IGL02947:Hydin APN 8 111,145,094 (GRCm39) missense probably damaging 0.96
IGL03136:Hydin APN 8 111,145,156 (GRCm39) missense probably benign 0.22
IGL03248:Hydin APN 8 111,321,921 (GRCm39) missense probably damaging 0.97
IGL03251:Hydin APN 8 111,217,228 (GRCm39) missense probably damaging 1.00
IGL03350:Hydin APN 8 111,038,856 (GRCm39) missense possibly damaging 0.86
IGL03366:Hydin APN 8 110,993,995 (GRCm39) missense unknown
IGL03404:Hydin APN 8 111,296,409 (GRCm39) missense probably benign 0.06
Franz_joseph UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
jahreszeiten UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
maria UTSW 8 111,235,759 (GRCm39) splice site probably benign
schoepfung UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
surprise UTSW 8 111,254,648 (GRCm39) missense probably benign
teresa UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
BB001:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB004:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
BB011:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB014:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
P0005:Hydin UTSW 8 111,220,921 (GRCm39) critical splice acceptor site probably null
R0099:Hydin UTSW 8 111,316,193 (GRCm39) missense probably damaging 1.00
R0125:Hydin UTSW 8 111,189,163 (GRCm39) missense probably benign 0.12
R0157:Hydin UTSW 8 111,026,642 (GRCm39) missense possibly damaging 0.86
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0255:Hydin UTSW 8 111,291,650 (GRCm39) missense probably benign 0.00
R0352:Hydin UTSW 8 111,296,533 (GRCm39) critical splice donor site probably null
R0379:Hydin UTSW 8 111,235,759 (GRCm39) splice site probably benign
R0468:Hydin UTSW 8 111,139,855 (GRCm39) missense possibly damaging 0.96
R0477:Hydin UTSW 8 111,145,130 (GRCm39) missense probably damaging 1.00
R0479:Hydin UTSW 8 111,325,720 (GRCm39) missense probably damaging 1.00
R0539:Hydin UTSW 8 111,249,704 (GRCm39) missense probably benign
R0550:Hydin UTSW 8 111,314,407 (GRCm39) missense probably benign 0.01
R0571:Hydin UTSW 8 111,240,735 (GRCm39) splice site probably null
R0606:Hydin UTSW 8 111,276,430 (GRCm39) splice site probably benign
R0789:Hydin UTSW 8 111,293,603 (GRCm39) missense possibly damaging 0.53
R0849:Hydin UTSW 8 111,325,616 (GRCm39) missense probably damaging 1.00
R0946:Hydin UTSW 8 111,257,685 (GRCm39) missense probably benign 0.25
R1201:Hydin UTSW 8 111,296,487 (GRCm39) missense probably benign 0.01
R1375:Hydin UTSW 8 111,232,854 (GRCm39) critical splice donor site probably null
R1385:Hydin UTSW 8 111,249,836 (GRCm39) missense probably benign 0.40
R1411:Hydin UTSW 8 111,301,663 (GRCm39) missense probably benign 0.04
R1437:Hydin UTSW 8 111,308,617 (GRCm39) nonsense probably null
R1447:Hydin UTSW 8 111,249,798 (GRCm39) missense probably damaging 1.00
R1448:Hydin UTSW 8 111,173,217 (GRCm39) missense probably benign 0.27
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1523:Hydin UTSW 8 111,259,903 (GRCm39) missense probably benign 0.05
R1544:Hydin UTSW 8 111,301,486 (GRCm39) missense probably benign 0.30
R1581:Hydin UTSW 8 111,137,092 (GRCm39) missense probably benign
R1584:Hydin UTSW 8 111,307,447 (GRCm39) missense probably benign 0.27
R1598:Hydin UTSW 8 111,137,306 (GRCm39) missense possibly damaging 0.96
R1633:Hydin UTSW 8 111,233,614 (GRCm39) missense probably benign 0.10
R1777:Hydin UTSW 8 111,316,203 (GRCm39) missense probably benign 0.14
R1817:Hydin UTSW 8 111,259,459 (GRCm39) missense probably benign 0.00
R1828:Hydin UTSW 8 111,237,526 (GRCm39) missense probably benign 0.03
R1837:Hydin UTSW 8 111,296,257 (GRCm39) missense probably benign 0.20
R1848:Hydin UTSW 8 111,296,440 (GRCm39) missense probably benign 0.19
R1869:Hydin UTSW 8 111,227,337 (GRCm39) missense possibly damaging 0.94
R1909:Hydin UTSW 8 111,314,404 (GRCm39) missense probably damaging 1.00
R1928:Hydin UTSW 8 111,229,579 (GRCm39) missense possibly damaging 0.93
R1950:Hydin UTSW 8 111,336,619 (GRCm39) missense possibly damaging 0.64
R2095:Hydin UTSW 8 111,189,289 (GRCm39) missense probably damaging 0.96
R2172:Hydin UTSW 8 111,308,681 (GRCm39) missense probably benign 0.42
R2217:Hydin UTSW 8 111,145,138 (GRCm39) missense probably benign
R2248:Hydin UTSW 8 111,304,835 (GRCm39) missense probably benign 0.09
R2272:Hydin UTSW 8 111,035,764 (GRCm39) missense probably benign 0.01
R2294:Hydin UTSW 8 111,026,591 (GRCm39) missense probably damaging 0.99
R2315:Hydin UTSW 8 111,124,676 (GRCm39) missense probably benign 0.01
R2330:Hydin UTSW 8 111,291,641 (GRCm39) missense probably benign 0.01
R2374:Hydin UTSW 8 111,291,780 (GRCm39) missense probably damaging 1.00
R2446:Hydin UTSW 8 111,314,347 (GRCm39) missense possibly damaging 0.82
R2484:Hydin UTSW 8 111,239,747 (GRCm39) missense possibly damaging 0.76
R2698:Hydin UTSW 8 111,336,561 (GRCm39) missense possibly damaging 0.70
R2843:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2844:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2846:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2882:Hydin UTSW 8 111,293,555 (GRCm39) missense possibly damaging 0.92
R2937:Hydin UTSW 8 111,130,927 (GRCm39) missense possibly damaging 0.88
R3031:Hydin UTSW 8 111,329,848 (GRCm39) missense possibly damaging 0.83
R3038:Hydin UTSW 8 111,309,321 (GRCm39) missense probably damaging 1.00
R3121:Hydin UTSW 8 111,233,138 (GRCm39) missense probably benign
R3157:Hydin UTSW 8 110,994,005 (GRCm39) missense unknown
R3547:Hydin UTSW 8 111,308,699 (GRCm39) missense possibly damaging 0.85
R3696:Hydin UTSW 8 111,329,911 (GRCm39) missense probably damaging 1.00
R3850:Hydin UTSW 8 111,290,561 (GRCm39) missense probably damaging 0.99
R3896:Hydin UTSW 8 111,235,711 (GRCm39) missense possibly damaging 0.93
R3983:Hydin UTSW 8 111,118,957 (GRCm39) missense probably damaging 1.00
R4031:Hydin UTSW 8 111,336,679 (GRCm39) missense probably benign 0.30
R4072:Hydin UTSW 8 111,231,888 (GRCm39) missense possibly damaging 0.68
R4095:Hydin UTSW 8 111,268,179 (GRCm39) missense probably damaging 0.98
R4176:Hydin UTSW 8 111,320,452 (GRCm39) missense probably benign 0.00
R4213:Hydin UTSW 8 111,183,139 (GRCm39) missense possibly damaging 0.91
R4412:Hydin UTSW 8 111,142,368 (GRCm39) missense probably damaging 0.99
R4471:Hydin UTSW 8 111,313,764 (GRCm39) missense probably damaging 1.00
R4474:Hydin UTSW 8 111,290,497 (GRCm39) missense probably benign 0.11
R4495:Hydin UTSW 8 111,322,034 (GRCm39) missense probably damaging 0.99
R4508:Hydin UTSW 8 111,245,886 (GRCm39) missense possibly damaging 0.91
R4578:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R4583:Hydin UTSW 8 111,321,857 (GRCm39) missense probably benign 0.36
R4600:Hydin UTSW 8 111,293,582 (GRCm39) missense probably benign 0.04
R4681:Hydin UTSW 8 111,233,103 (GRCm39) missense possibly damaging 0.85
R4685:Hydin UTSW 8 111,189,154 (GRCm39) missense probably damaging 0.99
R4689:Hydin UTSW 8 111,322,046 (GRCm39) missense probably benign 0.18
R4735:Hydin UTSW 8 111,282,264 (GRCm39) critical splice donor site probably null
R4736:Hydin UTSW 8 111,249,840 (GRCm39) missense probably benign 0.02
R4740:Hydin UTSW 8 111,173,071 (GRCm39) missense probably benign 0.06
R4771:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R4777:Hydin UTSW 8 111,137,096 (GRCm39) missense probably damaging 0.98
R4859:Hydin UTSW 8 111,233,126 (GRCm39) missense possibly damaging 0.93
R4911:Hydin UTSW 8 111,322,070 (GRCm39) missense probably benign 0.01
R4964:Hydin UTSW 8 111,217,305 (GRCm39) missense possibly damaging 0.86
R4965:Hydin UTSW 8 111,124,727 (GRCm39) missense probably benign
R4989:Hydin UTSW 8 111,290,554 (GRCm39) missense possibly damaging 0.84
R4995:Hydin UTSW 8 111,296,274 (GRCm39) missense probably damaging 0.97
R5059:Hydin UTSW 8 111,232,401 (GRCm39) missense probably damaging 0.96
R5071:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5073:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5092:Hydin UTSW 8 111,309,300 (GRCm39) missense probably benign 0.16
R5156:Hydin UTSW 8 111,336,333 (GRCm39) missense probably benign 0.00
R5166:Hydin UTSW 8 111,249,774 (GRCm39) missense possibly damaging 0.89
R5189:Hydin UTSW 8 111,139,843 (GRCm39) critical splice acceptor site probably null
R5243:Hydin UTSW 8 111,232,380 (GRCm39) missense possibly damaging 0.92
R5244:Hydin UTSW 8 111,259,451 (GRCm39) missense possibly damaging 0.77
R5256:Hydin UTSW 8 111,313,855 (GRCm39) missense possibly damaging 0.92
R5266:Hydin UTSW 8 111,061,416 (GRCm39) missense possibly damaging 0.87
R5283:Hydin UTSW 8 111,178,612 (GRCm39) missense possibly damaging 0.96
R5343:Hydin UTSW 8 111,212,051 (GRCm39) missense probably benign 0.40
R5359:Hydin UTSW 8 111,265,004 (GRCm39) missense probably benign 0.00
R5390:Hydin UTSW 8 111,322,099 (GRCm39) missense probably benign
R5394:Hydin UTSW 8 111,266,474 (GRCm39) splice site probably null
R5441:Hydin UTSW 8 111,291,741 (GRCm39) missense possibly damaging 0.72
R5461:Hydin UTSW 8 111,245,863 (GRCm39) missense probably damaging 0.96
R5662:Hydin UTSW 8 111,307,341 (GRCm39) missense probably benign 0.02
R5695:Hydin UTSW 8 111,261,915 (GRCm39) missense probably benign 0.35
R5732:Hydin UTSW 8 111,178,690 (GRCm39) missense probably benign 0.03
R5774:Hydin UTSW 8 111,298,547 (GRCm39) nonsense probably null
R5780:Hydin UTSW 8 111,312,712 (GRCm39) missense probably damaging 1.00
R5787:Hydin UTSW 8 111,052,985 (GRCm39) missense probably damaging 0.99
R5802:Hydin UTSW 8 111,178,692 (GRCm39) missense possibly damaging 0.86
R5841:Hydin UTSW 8 111,259,846 (GRCm39) missense possibly damaging 0.76
R5856:Hydin UTSW 8 111,268,474 (GRCm39) missense probably damaging 0.99
R5893:Hydin UTSW 8 111,217,308 (GRCm39) missense probably benign 0.12
R5963:Hydin UTSW 8 111,220,926 (GRCm39) missense possibly damaging 0.93
R6008:Hydin UTSW 8 111,325,717 (GRCm39) missense probably benign 0.02
R6019:Hydin UTSW 8 111,293,252 (GRCm39) missense probably benign
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6133:Hydin UTSW 8 111,327,908 (GRCm39) missense probably benign 0.00
R6135:Hydin UTSW 8 111,189,292 (GRCm39) missense possibly damaging 0.85
R6157:Hydin UTSW 8 111,254,648 (GRCm39) missense probably benign
R6209:Hydin UTSW 8 111,320,434 (GRCm39) missense probably benign 0.05
R6238:Hydin UTSW 8 111,118,743 (GRCm39) splice site probably null
R6293:Hydin UTSW 8 111,324,543 (GRCm39) missense possibly damaging 0.83
R6340:Hydin UTSW 8 111,081,574 (GRCm39) splice site probably null
R6349:Hydin UTSW 8 111,145,091 (GRCm39) nonsense probably null
R6357:Hydin UTSW 8 111,268,289 (GRCm39) missense possibly damaging 0.86
R6385:Hydin UTSW 8 111,038,856 (GRCm39) missense possibly damaging 0.86
R6396:Hydin UTSW 8 111,233,521 (GRCm39) missense probably damaging 0.96
R6466:Hydin UTSW 8 111,233,600 (GRCm39) missense possibly damaging 0.85
R6648:Hydin UTSW 8 111,252,299 (GRCm39) splice site probably null
R6671:Hydin UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
R6695:Hydin UTSW 8 111,053,092 (GRCm39) missense probably benign 0.05
R6800:Hydin UTSW 8 111,324,603 (GRCm39) missense probably benign 0.09
R6841:Hydin UTSW 8 111,265,007 (GRCm39) missense probably benign 0.09
R6867:Hydin UTSW 8 111,266,434 (GRCm39) missense probably benign 0.08
R6889:Hydin UTSW 8 111,259,488 (GRCm39) missense possibly damaging 0.79
R6895:Hydin UTSW 8 111,038,883 (GRCm39) missense probably benign 0.00
R6940:Hydin UTSW 8 111,217,243 (GRCm39) missense probably damaging 1.00
R6951:Hydin UTSW 8 111,124,757 (GRCm39) missense probably benign
R6980:Hydin UTSW 8 111,139,916 (GRCm39) missense possibly damaging 0.91
R6981:Hydin UTSW 8 111,257,704 (GRCm39) missense possibly damaging 0.89
R7061:Hydin UTSW 8 111,329,920 (GRCm39) missense possibly damaging 0.90
R7085:Hydin UTSW 8 111,329,962 (GRCm39) missense probably benign 0.03
R7086:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R7110:Hydin UTSW 8 111,081,583 (GRCm39) critical splice acceptor site probably null
R7158:Hydin UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
R7163:Hydin UTSW 8 111,329,968 (GRCm39) missense probably benign 0.25
R7209:Hydin UTSW 8 111,216,424 (GRCm39) nonsense probably null
R7244:Hydin UTSW 8 111,276,307 (GRCm39) missense probably damaging 0.98
R7347:Hydin UTSW 8 111,326,994 (GRCm39) missense probably benign 0.06
R7349:Hydin UTSW 8 111,124,803 (GRCm39) splice site probably null
R7359:Hydin UTSW 8 111,232,733 (GRCm39) missense probably damaging 0.98
R7365:Hydin UTSW 8 111,327,905 (GRCm39) missense probably damaging 1.00
R7365:Hydin UTSW 8 111,284,294 (GRCm39) missense probably damaging 0.99
R7436:Hydin UTSW 8 111,310,546 (GRCm39) missense probably damaging 0.96
R7528:Hydin UTSW 8 111,107,204 (GRCm39) nonsense probably null
R7544:Hydin UTSW 8 111,316,157 (GRCm39) missense probably benign 0.35
R7625:Hydin UTSW 8 111,268,476 (GRCm39) missense probably benign 0.01
R7713:Hydin UTSW 8 111,320,444 (GRCm39) missense possibly damaging 0.69
R7763:Hydin UTSW 8 111,232,475 (GRCm39) missense possibly damaging 0.92
R7771:Hydin UTSW 8 111,291,717 (GRCm39) missense probably damaging 0.97
R7794:Hydin UTSW 8 111,235,715 (GRCm39) missense probably damaging 1.00
R7833:Hydin UTSW 8 111,316,092 (GRCm39) missense probably damaging 0.99
R7894:Hydin UTSW 8 111,239,642 (GRCm39) missense possibly damaging 0.88
R7899:Hydin UTSW 8 111,314,380 (GRCm39) missense probably benign 0.00
R7908:Hydin UTSW 8 111,237,499 (GRCm39) missense probably benign 0.01
R7912:Hydin UTSW 8 111,282,239 (GRCm39) missense possibly damaging 0.68
R7919:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R7924:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
R7927:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
R7970:Hydin UTSW 8 111,035,723 (GRCm39) missense probably damaging 0.99
R7993:Hydin UTSW 8 111,306,264 (GRCm39) missense probably benign
R8011:Hydin UTSW 8 111,310,541 (GRCm39) missense probably damaging 1.00
R8041:Hydin UTSW 8 111,301,626 (GRCm39) missense probably benign 0.02
R8080:Hydin UTSW 8 111,261,863 (GRCm39) missense probably benign 0.32
R8081:Hydin UTSW 8 111,092,101 (GRCm39) missense possibly damaging 0.93
R8095:Hydin UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
R8157:Hydin UTSW 8 111,178,668 (GRCm39) missense probably benign 0.33
R8186:Hydin UTSW 8 111,336,277 (GRCm39) missense probably benign 0.14
R8205:Hydin UTSW 8 111,319,270 (GRCm39) missense possibly damaging 0.57
R8263:Hydin UTSW 8 111,178,705 (GRCm39) missense probably benign 0.00
R8288:Hydin UTSW 8 111,233,661 (GRCm39) missense probably damaging 0.96
R8298:Hydin UTSW 8 111,327,015 (GRCm39) missense probably damaging 1.00
R8309:Hydin UTSW 8 111,334,534 (GRCm39) missense probably benign 0.18
R8348:Hydin UTSW 8 111,329,878 (GRCm39) missense possibly damaging 0.68
R8356:Hydin UTSW 8 111,259,756 (GRCm39) missense possibly damaging 0.67
R8406:Hydin UTSW 8 111,336,543 (GRCm39) missense possibly damaging 0.94
R8415:Hydin UTSW 8 111,178,626 (GRCm39) missense probably damaging 1.00
R8417:Hydin UTSW 8 111,296,024 (GRCm39) missense probably benign 0.28
R8432:Hydin UTSW 8 111,324,583 (GRCm39) missense probably benign 0.02
R8437:Hydin UTSW 8 111,189,367 (GRCm39) missense probably damaging 0.96
R8463:Hydin UTSW 8 111,237,553 (GRCm39) missense probably benign 0.22
R8508:Hydin UTSW 8 111,308,650 (GRCm39) missense probably benign 0.00
R8510:Hydin UTSW 8 111,233,202 (GRCm39) missense probably damaging 1.00
R8560:Hydin UTSW 8 111,265,106 (GRCm39) missense probably benign 0.09
R8682:Hydin UTSW 8 111,035,798 (GRCm39) missense probably damaging 0.96
R8697:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R8857:Hydin UTSW 8 111,298,587 (GRCm39) critical splice donor site probably null
R8866:Hydin UTSW 8 111,308,779 (GRCm39) missense possibly damaging 0.89
R8878:Hydin UTSW 8 111,035,720 (GRCm39) missense probably benign 0.12
R8897:Hydin UTSW 8 111,316,112 (GRCm39) missense probably benign
R9072:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9073:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9102:Hydin UTSW 8 111,235,546 (GRCm39) missense probably benign 0.33
R9224:Hydin UTSW 8 111,259,516 (GRCm39) missense probably benign
R9255:Hydin UTSW 8 111,261,972 (GRCm39) missense probably benign 0.23
R9257:Hydin UTSW 8 111,301,648 (GRCm39) missense probably damaging 0.99
R9261:Hydin UTSW 8 110,994,047 (GRCm39) missense unknown
R9273:Hydin UTSW 8 111,233,580 (GRCm39) missense probably damaging 0.98
R9376:Hydin UTSW 8 111,124,695 (GRCm39) missense possibly damaging 0.70
R9380:Hydin UTSW 8 111,290,504 (GRCm39) missense probably benign 0.07
R9386:Hydin UTSW 8 111,314,362 (GRCm39) missense probably benign
R9406:Hydin UTSW 8 111,314,412 (GRCm39) missense probably null 0.96
R9492:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R9513:Hydin UTSW 8 111,322,114 (GRCm39) missense probably damaging 0.99
R9562:Hydin UTSW 8 111,312,786 (GRCm39) missense probably benign 0.11
R9664:Hydin UTSW 8 111,220,965 (GRCm39) missense probably benign 0.01
R9733:Hydin UTSW 8 111,262,011 (GRCm39) missense probably benign
R9753:Hydin UTSW 8 111,217,398 (GRCm39) missense possibly damaging 0.85
X0063:Hydin UTSW 8 111,277,951 (GRCm39) missense probably damaging 1.00
Z1088:Hydin UTSW 8 111,319,423 (GRCm39) frame shift probably null
Z1088:Hydin UTSW 8 111,312,680 (GRCm39) missense probably benign 0.00
Z1088:Hydin UTSW 8 111,026,605 (GRCm39) missense probably benign 0.12
Z1176:Hydin UTSW 8 111,268,232 (GRCm39) missense possibly damaging 0.65
Z1177:Hydin UTSW 8 111,313,774 (GRCm39) frame shift probably null
Z1177:Hydin UTSW 8 111,176,864 (GRCm39) missense possibly damaging 0.47
Z1177:Hydin UTSW 8 111,107,242 (GRCm39) missense probably damaging 1.00
Z1177:Hydin UTSW 8 111,336,621 (GRCm39) missense probably benign 0.10
Z1188:Hydin UTSW 8 111,142,419 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AACTCCCTTCCGGTGTGTT -3'
(R):5'- TCAACAGAGGGTGCATGTGG -3'

Sequencing Primer
(F):5'- GGTGTGTTTTCATCCTCTGCAC -3'
(R):5'- GGAGGTCACTGCCAGAAACC -3'
Posted On 2021-10-11