Incidental Mutation 'R8987:Mycbp2'
ID 684153
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene Name MYC binding protein 2
Synonyms C130061D10Rik, Phr1, Pam
MMRRC Submission
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103113411-103346814 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103208796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1865 (N1865K)
Ref Sequence ENSEMBL: ENSMUSP00000124710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000159855
AA Change: N1865K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: N1865K

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160758
AA Change: N1832K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: N1832K

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C T 11: 97,775,684 V59M probably damaging Het
1700069L16Rik T C 5: 113,692,752 K59R unknown Het
Abcb4 T C 5: 8,927,931 V503A probably benign Het
Actn4 A G 7: 28,896,973 V699A probably benign Het
Adam26a T A 8: 43,569,321 K377N probably benign Het
Adam6b C T 12: 113,491,128 R522C probably damaging Het
Ahi1 A G 10: 20,963,784 Y198C probably damaging Het
Ankrd44 G A 1: 54,661,190 Q720* probably null Het
Arhgap26 A T 18: 39,357,599 M297L Het
Arhgef11 C T 3: 87,730,481 T1093I probably damaging Het
Arhgef25 C A 10: 127,182,866 R609S probably damaging Het
Arhgef28 G T 13: 98,053,964 H162Q possibly damaging Het
Atg4b A G 1: 93,778,359 E178G possibly damaging Het
Atxn1l T C 8: 109,732,485 T382A probably benign Het
Bdp1 A G 13: 100,067,513 V667A probably benign Het
C6 T C 15: 4,814,862 I922T Het
Ccdc191 A G 16: 43,931,347 T347A probably benign Het
Cd22 G T 7: 30,877,747 P45H probably damaging Het
Cdc45 A G 16: 18,811,550 F6L probably benign Het
Cenpj T C 14: 56,526,926 E1343G possibly damaging Het
Chtf8 T A 8: 106,886,103 N68I probably benign Het
Cldn8 C T 16: 88,562,845 C64Y probably damaging Het
Cntnap2 G T 6: 46,484,049 S673I probably benign Het
Cyp3a13 C T 5: 137,911,587 R158K probably benign Het
Cyp3a57 A T 5: 145,374,229 probably null Het
Cyp3a57 G T 5: 145,374,230 probably null Het
D630045J12Rik A G 6: 38,196,963 I90T probably benign Het
Dapk2 A G 9: 66,250,320 probably benign Het
Dmxl1 A G 18: 49,893,852 D2009G Het
Dnah1 C T 14: 31,311,747 V290I possibly damaging Het
Doc2g A T 19: 4,004,511 probably null Het
Dpysl2 C T 14: 66,807,953 G457D probably damaging Het
Drc1 A T 5: 30,364,095 Y700F probably damaging Het
Ehbp1 A G 11: 22,053,531 Y1073H probably damaging Het
Epm2aip1 T A 9: 111,271,968 M3K probably benign Het
Erich3 G A 3: 154,709,703 R152Q Het
Exoc5 C T 14: 49,015,529 R609H probably damaging Het
Fam135b T A 15: 71,462,340 T1002S probably benign Het
Fanca C T 8: 123,297,799 E528K probably damaging Het
Fsd2 C A 7: 81,560,018 M25I probably benign Het
Fyco1 T C 9: 123,829,074 E679G possibly damaging Het
Gas6 T A 8: 13,470,294 M465L probably damaging Het
Gfra3 A G 18: 34,690,826 V365A probably benign Het
Gm10269 T G 18: 20,682,924 K14Q possibly damaging Het
Gm21798 G A 15: 64,817,907 probably null Het
Gm5916 T A 9: 36,120,990 R49S probably benign Het
Gpam G T 19: 55,083,795 T266N possibly damaging Het
Gtse1 A G 15: 85,868,908 E408G probably benign Het
Hmgcll1 A T 9: 76,130,310 probably null Het
Hspa12a T A 19: 58,799,471 R640* probably null Het
Hspa9 T C 18: 34,947,929 D233G probably damaging Het
Htt T G 5: 34,820,024 I751M probably benign Het
Hydin T A 8: 110,513,134 Y2015* probably null Het
Ift43 A C 12: 86,161,501 M138L probably benign Het
Il11 C T 7: 4,776,030 V93M probably damaging Het
Iws1 T A 18: 32,093,592 F741L possibly damaging Het
Jmy A T 13: 93,452,889 I620N probably damaging Het
Kap T A 6: 133,853,726 probably benign Het
Kcnk15 A G 2: 163,858,297 N152S probably damaging Het
Kif16b C T 2: 142,849,863 probably null Het
Kif16b T C 2: 142,901,358 K5R probably benign Het
Kirrel C T 3: 87,085,093 R555H probably damaging Het
Krt36 A G 11: 100,103,546 V235A possibly damaging Het
Lca5 A G 9: 83,401,743 S246P probably damaging Het
Maml1 T C 11: 50,266,748 D200G probably damaging Het
Maml3 T C 3: 51,690,447 R939G probably damaging Het
Mgam A T 6: 40,729,636 T74S probably damaging Het
Mib2 G T 4: 155,660,894 D125E probably benign Het
Muc16 A T 9: 18,551,685 L7407* probably null Het
Naip1 A G 13: 100,426,926 L577S probably damaging Het
Nell1 A T 7: 50,848,651 D652V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 probably benign Het
Oas1h T A 5: 120,867,089 I200N probably damaging Het
Olfr753-ps1 A G 17: 37,169,976 L122P probably damaging Het
Olfr753-ps1 A T 17: 37,170,099 I81N probably damaging Het
Olfr968 A T 9: 39,772,392 M136K probably benign Het
Otog A T 7: 46,287,454 Q1529L probably benign Het
Otop1 A T 5: 38,299,727 I277F probably damaging Het
Pax5 G A 4: 44,645,661 Q223* probably null Het
Pcdha9 T A 18: 36,999,945 I689N probably benign Het
Pcsk6 A T 7: 65,927,227 R138* probably null Het
Pitpnm3 A T 11: 72,112,306 N59K probably damaging Het
Pla2g4d G A 2: 120,269,961 T630I probably damaging Het
Plekhg5 T A 4: 152,103,915 probably benign Het
Plxnb1 T A 9: 109,108,110 probably benign Het
Prss28 T A 17: 25,309,421 L6H probably damaging Het
Pyroxd1 T A 6: 142,356,525 V228E Het
Ripk2 G A 4: 16,123,699 T492M possibly damaging Het
Satb1 A T 17: 51,805,353 C78S probably damaging Het
Scaf11 A T 15: 96,418,676 C1002* probably null Het
Scarf2 A C 16: 17,804,904 Q499P probably damaging Het
Selenbp1 T A 3: 94,940,114 M244K probably benign Het
Sik2 T C 9: 50,895,347 N921S probably benign Het
Slc25a1 A T 16: 17,925,880 V290E probably damaging Het
Slc28a3 C T 13: 58,571,440 probably benign Het
Slc35b4 A T 6: 34,160,507 D213E probably benign Het
Slc40a1 A C 1: 45,911,335 M319R probably damaging Het
Slc8a1 A T 17: 81,647,853 F585L possibly damaging Het
Slco3a1 T A 7: 74,320,576 N428Y possibly damaging Het
Slfn2 G A 11: 83,069,537 C114Y probably damaging Het
Smg5 T C 3: 88,360,407 probably null Het
Spata13 T A 14: 60,756,447 L1116Q possibly damaging Het
Syne1 A G 10: 5,227,579 V4965A possibly damaging Het
Tacc3 G T 5: 33,668,825 V472F possibly damaging Het
Tacr3 T A 3: 134,854,812 Y171N probably damaging Het
Tacr3 T G 3: 134,854,957 L219R probably damaging Het
Tbx3 C A 5: 119,680,821 A507E possibly damaging Het
Telo2 A T 17: 25,105,428 D494E probably damaging Het
Tfip11 T C 5: 112,337,055 F744S possibly damaging Het
Tgm3 A C 2: 130,038,483 N403T probably benign Het
Thoc3 A T 13: 54,467,895 S119T possibly damaging Het
Tmem176b A T 6: 48,835,596 I145N probably damaging Het
Trio T A 15: 27,732,687 Q3036L probably benign Het
Trpc4 T C 3: 54,194,711 V10A probably benign Het
Trpm3 A G 19: 22,918,760 Y987C probably damaging Het
Tspoap1 A G 11: 87,763,568 K225E probably damaging Het
Txnrd3 A T 6: 89,661,495 Q222L possibly damaging Het
Usp34 A T 11: 23,464,267 M2756L Het
Vmn2r81 C T 10: 79,293,870 T865I probably damaging Het
Vnn1 A G 10: 23,900,816 Y355C probably damaging Het
Wipf2 A T 11: 98,892,266 S173C probably damaging Het
Wnt1 A T 15: 98,791,743 H137L probably damaging Het
Xylt2 A T 11: 94,670,452 C162S probably damaging Het
Zfp426 T C 9: 20,476,448 E33G probably damaging Het
Zfp811 A C 17: 32,798,827 C80G possibly damaging Het
Zfp931 T C 2: 178,067,798 H265R probably damaging Het
Zfp931 G A 2: 178,067,799 H265Y probably damaging Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103223050 missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103155808 missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103201352 missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103194621 missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103126753 missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103291283 splice site probably benign
IGL00960:Mycbp2 APN 14 103229384 missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103172642 missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103122547 missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103155510 missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103229492 splice site probably null
IGL01586:Mycbp2 APN 14 103140869 critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103291287 critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103127979 missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103135204 nonsense probably null
IGL01820:Mycbp2 APN 14 103188501 missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103143211 missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103154907 nonsense probably null
IGL02178:Mycbp2 APN 14 103224366 missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103242207 missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103314375 missense probably benign
IGL02607:Mycbp2 APN 14 103285273 missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103205185 missense probably benign
IGL02702:Mycbp2 APN 14 103220124 missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103155261 missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103114242 splice site probably benign
IGL02866:Mycbp2 APN 14 103129992 missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103177279 missense probably benign
IGL03082:Mycbp2 APN 14 103204369 missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103298776 missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103155453 missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103298698 missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103188589 missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103247758 missense probably damaging 1.00
decompose UTSW 14 103219979 missense probably benign 0.12
moulder UTSW 14 103188592 missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103224462 splice site probably benign
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103152142 missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103156634 unclassified probably benign
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103314325 nonsense probably null
R0388:Mycbp2 UTSW 14 103156667 missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103135133 missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103182459 missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103196391 unclassified probably benign
R0671:Mycbp2 UTSW 14 103194588 missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103174794 missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103220013 missense probably benign
R0903:Mycbp2 UTSW 14 103275857 missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103262693 unclassified probably benign
R0961:Mycbp2 UTSW 14 103184835 missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103140917 missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103174826 missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103200152 nonsense probably null
R1211:Mycbp2 UTSW 14 103120563 missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103208782 missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103155898 missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103298867 splice site probably benign
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103204389 missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103232597 missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103169851 splice site probably null
R1565:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103247758 missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103227511 missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103224416 missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103182419 missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103155714 missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103184883 missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103229404 missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103145971 missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103248403 missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103188592 missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103260239 missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103232524 critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103287260 missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103220076 missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103201230 missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103145942 missense probably benign
R2135:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2146:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103169855 critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103169859 missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103262749 missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103144338 missense probably null 0.66
R2379:Mycbp2 UTSW 14 103174950 missense probably benign
R2495:Mycbp2 UTSW 14 103200118 missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103131245 missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103155255 missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103297358 missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103208743 splice site probably benign
R3404:Mycbp2 UTSW 14 103200114 missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103135117 missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103229430 missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103156414 missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103133788 missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103197285 missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103174797 missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103126713 missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103204500 missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103295252 missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103138725 splice site probably benign
R4021:Mycbp2 UTSW 14 103152157 missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103248457 missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103123445 missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103287228 missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103135266 missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103133789 missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103188502 missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103155658 missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103346297 missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103177313 missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103188591 missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103219944 missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103229437 missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103211295 missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103145946 missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103287239 missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103260385 splice site probably null
R4994:Mycbp2 UTSW 14 103169994 missense probably benign
R5029:Mycbp2 UTSW 14 103156510 missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103296939 missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103139235 critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103346214 critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103346321 missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103185683 critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103242432 nonsense probably null
R5414:Mycbp2 UTSW 14 103306261 missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103201401 missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103200126 missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103242179 missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103173814 missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103295237 missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103282645 nonsense probably null
R5569:Mycbp2 UTSW 14 103135243 missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103142767 missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103291333 missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103123355 missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103194677 missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188608 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188615 critical splice acceptor site probably null
R5646:Mycbp2 UTSW 14 103169910 missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103291342 missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103282665 missense probably null 0.99
R5668:Mycbp2 UTSW 14 103120519 missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103156453 missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103148550 missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103133974 missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103124403 missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103126684 missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103156723 missense probably benign
R6063:Mycbp2 UTSW 14 103135146 missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103223046 missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103275887 missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103285400 missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103155509 nonsense probably null
R6161:Mycbp2 UTSW 14 103298747 missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103147017 missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103295228 missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103260229 missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103155426 missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103262740 missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103155852 missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103155475 missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103136557 critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103142881 missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103191567 missense probably null 1.00
R6821:Mycbp2 UTSW 14 103139409 missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103260194 critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103285267 missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103154906 missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103206681 missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103174981 missense probably benign
R7054:Mycbp2 UTSW 14 103156098 missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103122603 missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103154077 missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103282679 missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103260200 missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103133846 missense probably benign
R7234:Mycbp2 UTSW 14 103215337 missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103156297 missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103208909 missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103197243 critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103120591 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103156453 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103197357 missense probably damaging 0.97
R7384:Mycbp2 UTSW 14 103276393 missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103152191 missense probably damaging 1.00
R7392:Mycbp2 UTSW 14 103243128 missense probably damaging 0.99
R7409:Mycbp2 UTSW 14 103288744 missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103197254 missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103346265 missense probably benign
R7661:Mycbp2 UTSW 14 103212623 missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103191609 missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103123355 missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103191619 missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103248404 missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103127097 missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103139415 missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
R7942:Mycbp2 UTSW 14 103155238 missense probably damaging 0.99
R7951:Mycbp2 UTSW 14 103215462 missense probably damaging 0.99
R7958:Mycbp2 UTSW 14 103129964 missense probably benign 0.00
R8235:Mycbp2 UTSW 14 103198674 missense probably damaging 0.99
R8246:Mycbp2 UTSW 14 103155204 missense probably damaging 0.99
R8338:Mycbp2 UTSW 14 103135265 missense probably damaging 1.00
R8343:Mycbp2 UTSW 14 103160675 splice site probably null
R8361:Mycbp2 UTSW 14 103138814 missense probably damaging 1.00
R8490:Mycbp2 UTSW 14 103208831 missense probably benign 0.00
R8524:Mycbp2 UTSW 14 103155459 missense probably benign 0.23
R8525:Mycbp2 UTSW 14 103212719 missense probably damaging 1.00
R8711:Mycbp2 UTSW 14 103169994 missense probably benign 0.08
R8735:Mycbp2 UTSW 14 103223150 missense probably damaging 0.99
R8825:Mycbp2 UTSW 14 103229435 missense probably damaging 1.00
R8928:Mycbp2 UTSW 14 103156345 missense probably benign
R8974:Mycbp2 UTSW 14 103124421 missense probably damaging 1.00
R9021:Mycbp2 UTSW 14 103314316 missense probably benign 0.08
R9062:Mycbp2 UTSW 14 103242360 missense probably benign 0.00
R9077:Mycbp2 UTSW 14 103232538 missense probably damaging 1.00
R9208:Mycbp2 UTSW 14 103295228 missense probably benign 0.01
R9285:Mycbp2 UTSW 14 103197317 missense probably damaging 0.97
R9290:Mycbp2 UTSW 14 103188524 missense probably damaging 0.99
R9362:Mycbp2 UTSW 14 103260206 missense probably damaging 0.97
R9520:Mycbp2 UTSW 14 103260269 missense probably benign 0.02
R9557:Mycbp2 UTSW 14 103135261 missense probably benign 0.03
R9639:Mycbp2 UTSW 14 103196381 missense probably damaging 1.00
R9666:Mycbp2 UTSW 14 103134038 missense probably damaging 0.98
R9732:Mycbp2 UTSW 14 103211313 missense probably damaging 1.00
R9736:Mycbp2 UTSW 14 103197416 missense probably damaging 0.96
R9739:Mycbp2 UTSW 14 103282793 missense probably benign 0.11
R9755:Mycbp2 UTSW 14 103314370 missense probably benign
X0024:Mycbp2 UTSW 14 103146942 missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103156637 missense probably benign 0.06
Z1176:Mycbp2 UTSW 14 103346249 missense probably benign
Z1177:Mycbp2 UTSW 14 103127063 critical splice donor site probably null
Z1177:Mycbp2 UTSW 14 103135123 missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103169873 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTTTGACTAAGTATGTGCTAGGAAG -3'
(R):5'- GCACTGATAACCTGTAGTTGTTG -3'

Sequencing Primer
(F):5'- TGTGCTAGGAAGATAAACTGTAATTC -3'
(R):5'- GATGGTCAACTGCTAGTTTCACCG -3'
Posted On 2021-10-11