Incidental Mutation 'R8987:Iws1'
ID 684174
Institutional Source Beutler Lab
Gene Symbol Iws1
Ensembl Gene ENSMUSG00000024384
Gene Name IWS1, SUPT6 interacting protein
Synonyms 1700069O15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 32067741-32104328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32093592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 741 (F741L)
Ref Sequence ENSEMBL: ENSMUSP00000148514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025243] [ENSMUST00000212675]
AlphaFold Q8C1D8
Predicted Effect probably benign
Transcript: ENSMUST00000025243
SMART Domains Protein: ENSMUSP00000025243
Gene: ENSMUSG00000024384

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 73 86 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
internal_repeat_2 112 179 9.21e-13 PROSPERO
internal_repeat_1 118 184 9.82e-20 PROSPERO
internal_repeat_1 183 296 9.82e-20 PROSPERO
internal_repeat_2 229 316 9.21e-13 PROSPERO
low complexity region 320 332 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
low complexity region 384 404 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
Pfam:Med26 584 636 4.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212458
Predicted Effect possibly damaging
Transcript: ENSMUST00000212675
AA Change: F741L

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000213074
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C T 11: 97,775,684 V59M probably damaging Het
1700069L16Rik T C 5: 113,692,752 K59R unknown Het
Abcb4 T C 5: 8,927,931 V503A probably benign Het
Actn4 A G 7: 28,896,973 V699A probably benign Het
Adam26a T A 8: 43,569,321 K377N probably benign Het
Adam6b C T 12: 113,491,128 R522C probably damaging Het
Ahi1 A G 10: 20,963,784 Y198C probably damaging Het
Ankrd44 G A 1: 54,661,190 Q720* probably null Het
Arhgap26 A T 18: 39,357,599 M297L Het
Arhgef11 C T 3: 87,730,481 T1093I probably damaging Het
Arhgef25 C A 10: 127,182,866 R609S probably damaging Het
Arhgef28 G T 13: 98,053,964 H162Q possibly damaging Het
Atg4b A G 1: 93,778,359 E178G possibly damaging Het
Atxn1l T C 8: 109,732,485 T382A probably benign Het
Bdp1 A G 13: 100,067,513 V667A probably benign Het
C6 T C 15: 4,814,862 I922T Het
Ccdc191 A G 16: 43,931,347 T347A probably benign Het
Cd22 G T 7: 30,877,747 P45H probably damaging Het
Cdc45 A G 16: 18,811,550 F6L probably benign Het
Cenpj T C 14: 56,526,926 E1343G possibly damaging Het
Chtf8 T A 8: 106,886,103 N68I probably benign Het
Cldn8 C T 16: 88,562,845 C64Y probably damaging Het
Cntnap2 G T 6: 46,484,049 S673I probably benign Het
Cyp3a13 C T 5: 137,911,587 R158K probably benign Het
Cyp3a57 A T 5: 145,374,229 probably null Het
Cyp3a57 G T 5: 145,374,230 probably null Het
D630045J12Rik A G 6: 38,196,963 I90T probably benign Het
Dmxl1 A G 18: 49,893,852 D2009G Het
Dnah1 C T 14: 31,311,747 V290I possibly damaging Het
Doc2g A T 19: 4,004,511 probably null Het
Dpysl2 C T 14: 66,807,953 G457D probably damaging Het
Drc1 A T 5: 30,364,095 Y700F probably damaging Het
Ehbp1 A G 11: 22,053,531 Y1073H probably damaging Het
Epm2aip1 T A 9: 111,271,968 M3K probably benign Het
Erich3 G A 3: 154,709,703 R152Q Het
Exoc5 C T 14: 49,015,529 R609H probably damaging Het
Fam135b T A 15: 71,462,340 T1002S probably benign Het
Fanca C T 8: 123,297,799 E528K probably damaging Het
Fsd2 C A 7: 81,560,018 M25I probably benign Het
Fyco1 T C 9: 123,829,074 E679G possibly damaging Het
Gas6 T A 8: 13,470,294 M465L probably damaging Het
Gfra3 A G 18: 34,690,826 V365A probably benign Het
Gm10269 T G 18: 20,682,924 K14Q possibly damaging Het
Gm21798 G A 15: 64,817,907 probably null Het
Gm5916 T A 9: 36,120,990 R49S probably benign Het
Gpam G T 19: 55,083,795 T266N possibly damaging Het
Gtse1 A G 15: 85,868,908 E408G probably benign Het
Hmgcll1 A T 9: 76,130,310 probably null Het
Hspa12a T A 19: 58,799,471 R640* probably null Het
Hspa9 T C 18: 34,947,929 D233G probably damaging Het
Htt T G 5: 34,820,024 I751M probably benign Het
Hydin T A 8: 110,513,134 Y2015* probably null Het
Ift43 A C 12: 86,161,501 M138L probably benign Het
Il11 C T 7: 4,776,030 V93M probably damaging Het
Jmy A T 13: 93,452,889 I620N probably damaging Het
Kcnk15 A G 2: 163,858,297 N152S probably damaging Het
Kif16b C T 2: 142,849,863 probably null Het
Kirrel C T 3: 87,085,093 R555H probably damaging Het
Krt36 A G 11: 100,103,546 V235A possibly damaging Het
Lca5 A G 9: 83,401,743 S246P probably damaging Het
Maml1 T C 11: 50,266,748 D200G probably damaging Het
Maml3 T C 3: 51,690,447 R939G probably damaging Het
Mgam A T 6: 40,729,636 T74S probably damaging Het
Mib2 G T 4: 155,660,894 D125E probably benign Het
Muc16 A T 9: 18,551,685 L7407* probably null Het
Mycbp2 A T 14: 103,208,796 N1865K probably damaging Het
Naip1 A G 13: 100,426,926 L577S probably damaging Het
Nell1 A T 7: 50,848,651 D652V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oas1h T A 5: 120,867,089 I200N probably damaging Het
Olfr753-ps1 A G 17: 37,169,976 L122P probably damaging Het
Olfr753-ps1 A T 17: 37,170,099 I81N probably damaging Het
Olfr968 A T 9: 39,772,392 M136K probably benign Het
Otog A T 7: 46,287,454 Q1529L probably benign Het
Otop1 A T 5: 38,299,727 I277F probably damaging Het
Pax5 G A 4: 44,645,661 Q223* probably null Het
Pcdha9 T A 18: 36,999,945 I689N probably benign Het
Pcsk6 A T 7: 65,927,227 R138* probably null Het
Pitpnm3 A T 11: 72,112,306 N59K probably damaging Het
Pla2g4d G A 2: 120,269,961 T630I probably damaging Het
Prss28 T A 17: 25,309,421 L6H probably damaging Het
Pyroxd1 T A 6: 142,356,525 V228E Het
Ripk2 G A 4: 16,123,699 T492M possibly damaging Het
Satb1 A T 17: 51,805,353 C78S probably damaging Het
Scaf11 A T 15: 96,418,676 C1002* probably null Het
Scarf2 A C 16: 17,804,904 Q499P probably damaging Het
Selenbp1 T A 3: 94,940,114 M244K probably benign Het
Sik2 T C 9: 50,895,347 N921S probably benign Het
Slc25a1 A T 16: 17,925,880 V290E probably damaging Het
Slc35b4 A T 6: 34,160,507 D213E probably benign Het
Slc40a1 A C 1: 45,911,335 M319R probably damaging Het
Slc8a1 A T 17: 81,647,853 F585L possibly damaging Het
Slco3a1 T A 7: 74,320,576 N428Y possibly damaging Het
Slfn2 G A 11: 83,069,537 C114Y probably damaging Het
Smg5 T C 3: 88,360,407 probably null Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Spata13 T A 14: 60,756,447 L1116Q possibly damaging Het
Syne1 A G 10: 5,227,579 V4965A possibly damaging Het
Tacc3 G T 5: 33,668,825 V472F possibly damaging Het
Tacr3 T A 3: 134,854,812 Y171N probably damaging Het
Tacr3 T G 3: 134,854,957 L219R probably damaging Het
Tbx3 C A 5: 119,680,821 A507E possibly damaging Het
Telo2 A T 17: 25,105,428 D494E probably damaging Het
Tfip11 T C 5: 112,337,055 F744S possibly damaging Het
Tgm3 A C 2: 130,038,483 N403T probably benign Het
Thoc3 A T 13: 54,467,895 S119T possibly damaging Het
Tmem176b A T 6: 48,835,596 I145N probably damaging Het
Trio T A 15: 27,732,687 Q3036L probably benign Het
Trpc4 T C 3: 54,194,711 V10A probably benign Het
Trpm3 A G 19: 22,918,760 Y987C probably damaging Het
Tspoap1 A G 11: 87,763,568 K225E probably damaging Het
Txnrd3 A T 6: 89,661,495 Q222L possibly damaging Het
Usp34 A T 11: 23,464,267 M2756L Het
Vmn2r81 C T 10: 79,293,870 T865I probably damaging Het
Vnn1 A G 10: 23,900,816 Y355C probably damaging Het
Wipf2 A T 11: 98,892,266 S173C probably damaging Het
Wnt1 A T 15: 98,791,743 H137L probably damaging Het
Xylt2 A T 11: 94,670,452 C162S probably damaging Het
Zfp426 T C 9: 20,476,448 E33G probably damaging Het
Zfp811 A C 17: 32,798,827 C80G possibly damaging Het
Zfp931 T C 2: 178,067,798 H265R probably damaging Het
Zfp931 G A 2: 178,067,799 H265Y probably damaging Het
Other mutations in Iws1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Iws1 APN 18 32084688 missense probably benign 0.07
IGL01432:Iws1 APN 18 32083466 splice site probably benign
IGL01647:Iws1 APN 18 32097222 nonsense probably null
IGL02054:Iws1 APN 18 32090542 critical splice donor site probably null
IGL02189:Iws1 APN 18 32093125 missense probably damaging 1.00
IGL02664:Iws1 APN 18 32070164 missense possibly damaging 0.81
IGL03384:Iws1 APN 18 32093150 missense probably damaging 1.00
IGL03394:Iws1 APN 18 32088248 splice site probably benign
R0352:Iws1 UTSW 18 32084205 missense probably damaging 1.00
R1385:Iws1 UTSW 18 32090430 missense probably benign 0.03
R1486:Iws1 UTSW 18 32097256 missense probably damaging 1.00
R1526:Iws1 UTSW 18 32080125 missense probably benign 0.00
R1529:Iws1 UTSW 18 32080281 missense probably benign
R2094:Iws1 UTSW 18 32084666 missense probably damaging 1.00
R3774:Iws1 UTSW 18 32079995 missense probably damaging 1.00
R3907:Iws1 UTSW 18 32079920 missense possibly damaging 0.93
R4018:Iws1 UTSW 18 32070152 nonsense probably null
R4423:Iws1 UTSW 18 32083450 missense probably damaging 1.00
R4703:Iws1 UTSW 18 32080013 missense probably benign 0.19
R4979:Iws1 UTSW 18 32093267 unclassified probably benign
R5228:Iws1 UTSW 18 32088261 missense probably damaging 1.00
R5352:Iws1 UTSW 18 32083404 missense probably damaging 1.00
R6428:Iws1 UTSW 18 32086290 missense probably damaging 1.00
R6846:Iws1 UTSW 18 32086273 unclassified probably benign
R6892:Iws1 UTSW 18 32086274 missense probably damaging 0.99
R7163:Iws1 UTSW 18 32093224 missense possibly damaging 0.80
R7540:Iws1 UTSW 18 32080483 missense possibly damaging 0.94
R7605:Iws1 UTSW 18 32089487 missense probably benign 0.01
R7714:Iws1 UTSW 18 32090515 missense probably benign 0.00
R8218:Iws1 UTSW 18 32093635 missense probably benign 0.00
R8229:Iws1 UTSW 18 32084687 missense probably benign
R8728:Iws1 UTSW 18 32083281 missense probably damaging 1.00
R9096:Iws1 UTSW 18 32083320 missense probably benign
R9187:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9188:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9189:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9190:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9284:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9302:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9351:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
R9352:Iws1 UTSW 18 32080160 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAAATTTACCTGCTTTCTCGGATCC -3'
(R):5'- GAAGCTGATTTCAGGCCAGG -3'

Sequencing Primer
(F):5'- CTCTCCATCTGCTTAAACAGTTC -3'
(R):5'- CCTAAGAAAGCACACACTTGTTTC -3'
Posted On 2021-10-11