Incidental Mutation 'R8987:Hspa9'
ID 684176
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Name heat shock protein 9
Synonyms C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34937414-34954357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34947929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 233 (D233G)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
AlphaFold P38647
Predicted Effect probably damaging
Transcript: ENSMUST00000025217
AA Change: D233G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: D233G

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C T 11: 97,775,684 V59M probably damaging Het
1700069L16Rik T C 5: 113,692,752 K59R unknown Het
Abcb4 T C 5: 8,927,931 V503A probably benign Het
Actn4 A G 7: 28,896,973 V699A probably benign Het
Adam26a T A 8: 43,569,321 K377N probably benign Het
Adam6b C T 12: 113,491,128 R522C probably damaging Het
Ahi1 A G 10: 20,963,784 Y198C probably damaging Het
Ankrd44 G A 1: 54,661,190 Q720* probably null Het
Arhgap26 A T 18: 39,357,599 M297L Het
Arhgef11 C T 3: 87,730,481 T1093I probably damaging Het
Arhgef25 C A 10: 127,182,866 R609S probably damaging Het
Arhgef28 G T 13: 98,053,964 H162Q possibly damaging Het
Atg4b A G 1: 93,778,359 E178G possibly damaging Het
Atxn1l T C 8: 109,732,485 T382A probably benign Het
Bdp1 A G 13: 100,067,513 V667A probably benign Het
C6 T C 15: 4,814,862 I922T Het
Ccdc191 A G 16: 43,931,347 T347A probably benign Het
Cd22 G T 7: 30,877,747 P45H probably damaging Het
Cdc45 A G 16: 18,811,550 F6L probably benign Het
Cenpj T C 14: 56,526,926 E1343G possibly damaging Het
Chtf8 T A 8: 106,886,103 N68I probably benign Het
Cldn8 C T 16: 88,562,845 C64Y probably damaging Het
Cntnap2 G T 6: 46,484,049 S673I probably benign Het
Cyp3a13 C T 5: 137,911,587 R158K probably benign Het
Cyp3a57 A T 5: 145,374,229 probably null Het
Cyp3a57 G T 5: 145,374,230 probably null Het
D630045J12Rik A G 6: 38,196,963 I90T probably benign Het
Dmxl1 A G 18: 49,893,852 D2009G Het
Dnah1 C T 14: 31,311,747 V290I possibly damaging Het
Doc2g A T 19: 4,004,511 probably null Het
Dpysl2 C T 14: 66,807,953 G457D probably damaging Het
Drc1 A T 5: 30,364,095 Y700F probably damaging Het
Ehbp1 A G 11: 22,053,531 Y1073H probably damaging Het
Epm2aip1 T A 9: 111,271,968 M3K probably benign Het
Erich3 G A 3: 154,709,703 R152Q Het
Exoc5 C T 14: 49,015,529 R609H probably damaging Het
Fam135b T A 15: 71,462,340 T1002S probably benign Het
Fanca C T 8: 123,297,799 E528K probably damaging Het
Fsd2 C A 7: 81,560,018 M25I probably benign Het
Fyco1 T C 9: 123,829,074 E679G possibly damaging Het
Gas6 T A 8: 13,470,294 M465L probably damaging Het
Gfra3 A G 18: 34,690,826 V365A probably benign Het
Gm10269 T G 18: 20,682,924 K14Q possibly damaging Het
Gm21798 G A 15: 64,817,907 probably null Het
Gm5916 T A 9: 36,120,990 R49S probably benign Het
Gpam G T 19: 55,083,795 T266N possibly damaging Het
Gtse1 A G 15: 85,868,908 E408G probably benign Het
Hmgcll1 A T 9: 76,130,310 probably null Het
Hspa12a T A 19: 58,799,471 R640* probably null Het
Htt T G 5: 34,820,024 I751M probably benign Het
Hydin T A 8: 110,513,134 Y2015* probably null Het
Ift43 A C 12: 86,161,501 M138L probably benign Het
Il11 C T 7: 4,776,030 V93M probably damaging Het
Iws1 T A 18: 32,093,592 F741L possibly damaging Het
Jmy A T 13: 93,452,889 I620N probably damaging Het
Kcnk15 A G 2: 163,858,297 N152S probably damaging Het
Kif16b C T 2: 142,849,863 probably null Het
Kirrel C T 3: 87,085,093 R555H probably damaging Het
Krt36 A G 11: 100,103,546 V235A possibly damaging Het
Lca5 A G 9: 83,401,743 S246P probably damaging Het
Maml1 T C 11: 50,266,748 D200G probably damaging Het
Maml3 T C 3: 51,690,447 R939G probably damaging Het
Mgam A T 6: 40,729,636 T74S probably damaging Het
Mib2 G T 4: 155,660,894 D125E probably benign Het
Muc16 A T 9: 18,551,685 L7407* probably null Het
Mycbp2 A T 14: 103,208,796 N1865K probably damaging Het
Naip1 A G 13: 100,426,926 L577S probably damaging Het
Nell1 A T 7: 50,848,651 D652V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oas1h T A 5: 120,867,089 I200N probably damaging Het
Olfr753-ps1 A G 17: 37,169,976 L122P probably damaging Het
Olfr753-ps1 A T 17: 37,170,099 I81N probably damaging Het
Olfr968 A T 9: 39,772,392 M136K probably benign Het
Otog A T 7: 46,287,454 Q1529L probably benign Het
Otop1 A T 5: 38,299,727 I277F probably damaging Het
Pax5 G A 4: 44,645,661 Q223* probably null Het
Pcdha9 T A 18: 36,999,945 I689N probably benign Het
Pcsk6 A T 7: 65,927,227 R138* probably null Het
Pitpnm3 A T 11: 72,112,306 N59K probably damaging Het
Pla2g4d G A 2: 120,269,961 T630I probably damaging Het
Prss28 T A 17: 25,309,421 L6H probably damaging Het
Pyroxd1 T A 6: 142,356,525 V228E Het
Ripk2 G A 4: 16,123,699 T492M possibly damaging Het
Satb1 A T 17: 51,805,353 C78S probably damaging Het
Scaf11 A T 15: 96,418,676 C1002* probably null Het
Scarf2 A C 16: 17,804,904 Q499P probably damaging Het
Selenbp1 T A 3: 94,940,114 M244K probably benign Het
Sik2 T C 9: 50,895,347 N921S probably benign Het
Slc25a1 A T 16: 17,925,880 V290E probably damaging Het
Slc35b4 A T 6: 34,160,507 D213E probably benign Het
Slc40a1 A C 1: 45,911,335 M319R probably damaging Het
Slc8a1 A T 17: 81,647,853 F585L possibly damaging Het
Slco3a1 T A 7: 74,320,576 N428Y possibly damaging Het
Slfn2 G A 11: 83,069,537 C114Y probably damaging Het
Smg5 T C 3: 88,360,407 probably null Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Spata13 T A 14: 60,756,447 L1116Q possibly damaging Het
Syne1 A G 10: 5,227,579 V4965A possibly damaging Het
Tacc3 G T 5: 33,668,825 V472F possibly damaging Het
Tacr3 T A 3: 134,854,812 Y171N probably damaging Het
Tacr3 T G 3: 134,854,957 L219R probably damaging Het
Tbx3 C A 5: 119,680,821 A507E possibly damaging Het
Telo2 A T 17: 25,105,428 D494E probably damaging Het
Tfip11 T C 5: 112,337,055 F744S possibly damaging Het
Tgm3 A C 2: 130,038,483 N403T probably benign Het
Thoc3 A T 13: 54,467,895 S119T possibly damaging Het
Tmem176b A T 6: 48,835,596 I145N probably damaging Het
Trio T A 15: 27,732,687 Q3036L probably benign Het
Trpc4 T C 3: 54,194,711 V10A probably benign Het
Trpm3 A G 19: 22,918,760 Y987C probably damaging Het
Tspoap1 A G 11: 87,763,568 K225E probably damaging Het
Txnrd3 A T 6: 89,661,495 Q222L possibly damaging Het
Usp34 A T 11: 23,464,267 M2756L Het
Vmn2r81 C T 10: 79,293,870 T865I probably damaging Het
Vnn1 A G 10: 23,900,816 Y355C probably damaging Het
Wipf2 A T 11: 98,892,266 S173C probably damaging Het
Wnt1 A T 15: 98,791,743 H137L probably damaging Het
Xylt2 A T 11: 94,670,452 C162S probably damaging Het
Zfp426 T C 9: 20,476,448 E33G probably damaging Het
Zfp811 A C 17: 32,798,827 C80G possibly damaging Het
Zfp931 T C 2: 178,067,798 H265R probably damaging Het
Zfp931 G A 2: 178,067,799 H265Y probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8524:Hspa9 UTSW 18 34954244 missense unknown
R8830:Hspa9 UTSW 18 34948104 critical splice donor site probably null
R9028:Hspa9 UTSW 18 34942031 missense probably damaging 1.00
R9184:Hspa9 UTSW 18 34949115 missense possibly damaging 0.87
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTGACATCTCTGTGTCAGG -3'
(R):5'- CACAGCGACAGGTAAAATTAGATCTC -3'

Sequencing Primer
(F):5'- CTCTGTGTCAGGATTAACATGC -3'
(R):5'- AAAATTAGATCTCTTGTTTGCTGGG -3'
Posted On 2021-10-11