Incidental Mutation 'R8987:Dmxl1'
ID684179
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R8987 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49893852 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2009 (D2009G)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: D2009G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: D2009G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: D2009G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C T 11: 97,775,684 V59M probably damaging Het
1700069L16Rik T C 5: 113,692,752 K59R unknown Het
Abcb4 T C 5: 8,927,931 V503A probably benign Het
Actn4 A G 7: 28,896,973 V699A probably benign Het
Adam26a T A 8: 43,569,321 K377N probably benign Het
Adam6b C T 12: 113,491,128 R522C probably damaging Het
Ahi1 A G 10: 20,963,784 Y198C probably damaging Het
Ankrd44 G A 1: 54,661,190 Q720* probably null Het
Arhgap26 A T 18: 39,357,599 M297L Het
Arhgef11 C T 3: 87,730,481 T1093I probably damaging Het
Arhgef25 C A 10: 127,182,866 R609S probably damaging Het
Arhgef28 G T 13: 98,053,964 H162Q possibly damaging Het
Atg4b A G 1: 93,778,359 E178G possibly damaging Het
Atxn1l T C 8: 109,732,485 T382A probably benign Het
Bdp1 A G 13: 100,067,513 V667A probably benign Het
C6 T C 15: 4,814,862 I922T Het
Ccdc191 A G 16: 43,931,347 T347A probably benign Het
Cd22 G T 7: 30,877,747 P45H probably damaging Het
Cdc45 A G 16: 18,811,550 F6L probably benign Het
Cenpj T C 14: 56,526,926 E1343G possibly damaging Het
Chtf8 T A 8: 106,886,103 N68I probably benign Het
Cldn8 C T 16: 88,562,845 C64Y probably damaging Het
Cntnap2 G T 6: 46,484,049 S673I probably benign Het
Cyp3a13 C T 5: 137,911,587 R158K probably benign Het
Cyp3a57 A T 5: 145,374,229 probably null Het
Cyp3a57 G T 5: 145,374,230 probably null Het
D630045J12Rik A G 6: 38,196,963 I90T probably benign Het
Dnah1 C T 14: 31,311,747 V290I possibly damaging Het
Doc2g A T 19: 4,004,511 probably null Het
Dpysl2 C T 14: 66,807,953 G457D probably damaging Het
Drc1 A T 5: 30,364,095 Y700F probably damaging Het
Ehbp1 A G 11: 22,053,531 Y1073H probably damaging Het
Epm2aip1 T A 9: 111,271,968 M3K probably benign Het
Erich3 G A 3: 154,709,703 R152Q Het
Exoc5 C T 14: 49,015,529 R609H probably damaging Het
Fam135b T A 15: 71,462,340 T1002S probably benign Het
Fanca C T 8: 123,297,799 E528K probably damaging Het
Fsd2 C A 7: 81,560,018 M25I probably benign Het
Fyco1 T C 9: 123,829,074 E679G possibly damaging Het
Gas6 T A 8: 13,470,294 M465L probably damaging Het
Gfra3 A G 18: 34,690,826 V365A probably benign Het
Gm10269 T G 18: 20,682,924 K14Q possibly damaging Het
Gm21798 G A 15: 64,817,907 probably null Het
Gm5916 T A 9: 36,120,990 R49S probably benign Het
Gpam G T 19: 55,083,795 T266N possibly damaging Het
Gtse1 A G 15: 85,868,908 E408G probably benign Het
Hmgcll1 A T 9: 76,130,310 probably null Het
Hspa12a T A 19: 58,799,471 R640* probably null Het
Hspa9 T C 18: 34,947,929 D233G probably damaging Het
Htt T G 5: 34,820,024 I751M probably benign Het
Hydin T A 8: 110,513,134 Y2015* probably null Het
Ift43 A C 12: 86,161,501 M138L probably benign Het
Il11 C T 7: 4,776,030 V93M probably damaging Het
Iws1 T A 18: 32,093,592 F741L possibly damaging Het
Jmy A T 13: 93,452,889 I620N probably damaging Het
Kcnk15 A G 2: 163,858,297 N152S probably damaging Het
Kif16b C T 2: 142,849,863 probably null Het
Kirrel C T 3: 87,085,093 R555H probably damaging Het
Krt36 A G 11: 100,103,546 V235A possibly damaging Het
Lca5 A G 9: 83,401,743 S246P probably damaging Het
Maml1 T C 11: 50,266,748 D200G probably damaging Het
Maml3 T C 3: 51,690,447 R939G probably damaging Het
Mgam A T 6: 40,729,636 T74S probably damaging Het
Mib2 G T 4: 155,660,894 D125E probably benign Het
Muc16 A T 9: 18,551,685 L7407* probably null Het
Mycbp2 A T 14: 103,208,796 N1865K probably damaging Het
Naip1 A G 13: 100,426,926 L577S probably damaging Het
Nell1 A T 7: 50,848,651 D652V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oas1h T A 5: 120,867,089 I200N probably damaging Het
Olfr753-ps1 A G 17: 37,169,976 L122P probably damaging Het
Olfr753-ps1 A T 17: 37,170,099 I81N probably damaging Het
Olfr968 A T 9: 39,772,392 M136K probably benign Het
Otog A T 7: 46,287,454 Q1529L probably benign Het
Otop1 A T 5: 38,299,727 I277F probably damaging Het
Pax5 G A 4: 44,645,661 Q223* probably null Het
Pcdha9 T A 18: 36,999,945 I689N probably benign Het
Pcsk6 A T 7: 65,927,227 R138* probably null Het
Pitpnm3 A T 11: 72,112,306 N59K probably damaging Het
Pla2g4d G A 2: 120,269,961 T630I probably damaging Het
Prss28 T A 17: 25,309,421 L6H probably damaging Het
Pyroxd1 T A 6: 142,356,525 V228E Het
Ripk2 G A 4: 16,123,699 T492M possibly damaging Het
Satb1 A T 17: 51,805,353 C78S probably damaging Het
Scaf11 A T 15: 96,418,676 C1002* probably null Het
Scarf2 A C 16: 17,804,904 Q499P probably damaging Het
Selenbp1 T A 3: 94,940,114 M244K probably benign Het
Sik2 T C 9: 50,895,347 N921S probably benign Het
Slc25a1 A T 16: 17,925,880 V290E probably damaging Het
Slc35b4 A T 6: 34,160,507 D213E probably benign Het
Slc40a1 A C 1: 45,911,335 M319R probably damaging Het
Slc8a1 A T 17: 81,647,853 F585L possibly damaging Het
Slco3a1 T A 7: 74,320,576 N428Y possibly damaging Het
Slfn2 G A 11: 83,069,537 C114Y probably damaging Het
Smg5 T C 3: 88,360,407 probably null Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Spata13 T A 14: 60,756,447 L1116Q possibly damaging Het
Syne1 A G 10: 5,227,579 V4965A possibly damaging Het
Tacc3 G T 5: 33,668,825 V472F possibly damaging Het
Tacr3 T A 3: 134,854,812 Y171N probably damaging Het
Tacr3 T G 3: 134,854,957 L219R probably damaging Het
Tbx3 C A 5: 119,680,821 A507E possibly damaging Het
Telo2 A T 17: 25,105,428 D494E probably damaging Het
Tfip11 T C 5: 112,337,055 F744S possibly damaging Het
Tgm3 A C 2: 130,038,483 N403T probably benign Het
Thoc3 A T 13: 54,467,895 S119T possibly damaging Het
Tmem176b A T 6: 48,835,596 I145N probably damaging Het
Trio T A 15: 27,732,687 Q3036L probably benign Het
Trpc4 T C 3: 54,194,711 V10A probably benign Het
Trpm3 A G 19: 22,918,760 Y987C probably damaging Het
Tspoap1 A G 11: 87,763,568 K225E probably damaging Het
Txnrd3 A T 6: 89,661,495 Q222L possibly damaging Het
Usp34 A T 11: 23,464,267 M2756L Het
Vmn2r81 C T 10: 79,293,870 T865I probably damaging Het
Vnn1 A G 10: 23,900,816 Y355C probably damaging Het
Wipf2 A T 11: 98,892,266 S173C probably damaging Het
Wnt1 A T 15: 98,791,743 H137L probably damaging Het
Xylt2 A T 11: 94,670,452 C162S probably damaging Het
Zfp426 T C 9: 20,476,448 E33G probably damaging Het
Zfp811 A C 17: 32,798,827 C80G possibly damaging Het
Zfp931 T C 2: 178,067,798 H265R probably damaging Het
Zfp931 G A 2: 178,067,799 H265Y probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
carnivora UTSW 18 49864383 missense probably damaging 0.99
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
R3889_Dmxl1_217 UTSW 18 49878259 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49898714 missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49878326 nonsense probably null
R8402:Dmxl1 UTSW 18 49878327 missense probably benign 0.09
R8402:Dmxl1 UTSW 18 49878342 missense probably benign
R8423:Dmxl1 UTSW 18 49865116 missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 49871692 nonsense probably null
R8702:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49955870 missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49957339 missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49878225 missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49939572 missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49864508 missense possibly damaging 0.96
R8971:Dmxl1 UTSW 18 49893674 missense probably damaging 1.00
R8978:Dmxl1 UTSW 18 49922612 missense probably benign 0.37
R9011:Dmxl1 UTSW 18 49864173 missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49893394 missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Z1188:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCGAGTGTGGTATTTCAAGATG -3'
(R):5'- CTAAATGTGGTCTGCAGCTGG -3'

Sequencing Primer
(F):5'- GGTATTTCAAGATGACTCTTTGGAG -3'
(R):5'- TGCGTCTGAGCAAAAGTCAC -3'
Posted On2021-10-11