Incidental Mutation 'R8987:Dmxl1'
ID 684179
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 068819-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50026919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2009 (D2009G)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: D2009G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: D2009G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: D2009G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T C 5: 113,830,813 (GRCm39) K59R unknown Het
Abcb4 T C 5: 8,977,931 (GRCm39) V503A probably benign Het
Actn4 A G 7: 28,596,398 (GRCm39) V699A probably benign Het
Adam26a T A 8: 44,022,358 (GRCm39) K377N probably benign Het
Adam6b C T 12: 113,454,748 (GRCm39) R522C probably damaging Het
Ahi1 A G 10: 20,839,683 (GRCm39) Y198C probably damaging Het
Ankrd44 G A 1: 54,700,349 (GRCm39) Q720* probably null Het
Arhgap26 A T 18: 39,490,652 (GRCm39) M297L Het
Arhgef11 C T 3: 87,637,788 (GRCm39) T1093I probably damaging Het
Arhgef25 C A 10: 127,018,735 (GRCm39) R609S probably damaging Het
Arhgef28 G T 13: 98,190,472 (GRCm39) H162Q possibly damaging Het
Atg4b A G 1: 93,706,081 (GRCm39) E178G possibly damaging Het
Atxn1l T C 8: 110,459,117 (GRCm39) T382A probably benign Het
Bdp1 A G 13: 100,204,021 (GRCm39) V667A probably benign Het
C6 T C 15: 4,844,344 (GRCm39) I922T Het
Ccdc191 A G 16: 43,751,710 (GRCm39) T347A probably benign Het
Cd22 G T 7: 30,577,172 (GRCm39) P45H probably damaging Het
Cdc45 A G 16: 18,630,300 (GRCm39) F6L probably benign Het
Cenpj T C 14: 56,764,383 (GRCm39) E1343G possibly damaging Het
Chtf8 T A 8: 107,612,735 (GRCm39) N68I probably benign Het
Cldn8 C T 16: 88,359,733 (GRCm39) C64Y probably damaging Het
Cntnap2 G T 6: 46,460,983 (GRCm39) S673I probably benign Het
Cyp3a13 C T 5: 137,909,849 (GRCm39) R158K probably benign Het
Cyp3a57 A T 5: 145,311,039 (GRCm39) probably null Het
Cyp3a57 G T 5: 145,311,040 (GRCm39) probably null Het
D630045J12Rik A G 6: 38,173,898 (GRCm39) I90T probably benign Het
Dapk2 A G 9: 66,157,602 (GRCm39) probably benign Het
Dnah1 C T 14: 31,033,704 (GRCm39) V290I possibly damaging Het
Doc2g A T 19: 4,054,511 (GRCm39) probably null Het
Dpysl2 C T 14: 67,045,402 (GRCm39) G457D probably damaging Het
Drc1 A T 5: 30,521,439 (GRCm39) Y700F probably damaging Het
Ehbp1 A G 11: 22,003,531 (GRCm39) Y1073H probably damaging Het
Epm2aip1 T A 9: 111,101,036 (GRCm39) M3K probably benign Het
Erich3 G A 3: 154,415,340 (GRCm39) R152Q Het
Exoc5 C T 14: 49,252,986 (GRCm39) R609H probably damaging Het
Fam135b T A 15: 71,334,189 (GRCm39) T1002S probably benign Het
Fanca C T 8: 124,024,538 (GRCm39) E528K probably damaging Het
Fsd2 C A 7: 81,209,766 (GRCm39) M25I probably benign Het
Fyco1 T C 9: 123,658,139 (GRCm39) E679G possibly damaging Het
Gas6 T A 8: 13,520,294 (GRCm39) M465L probably damaging Het
Gfra3 A G 18: 34,823,879 (GRCm39) V365A probably benign Het
Gm10269 T G 18: 20,815,981 (GRCm39) K14Q possibly damaging Het
Gm21798 G A 15: 64,689,756 (GRCm39) probably null Het
Gm5916 T A 9: 36,032,286 (GRCm39) R49S probably benign Het
Gpam G T 19: 55,072,227 (GRCm39) T266N possibly damaging Het
Gtse1 A G 15: 85,753,109 (GRCm39) E408G probably benign Het
Hmgcll1 A T 9: 76,037,592 (GRCm39) probably null Het
Hspa12a T A 19: 58,787,903 (GRCm39) R640* probably null Het
Hspa9 T C 18: 35,080,982 (GRCm39) D233G probably damaging Het
Htt T G 5: 34,977,368 (GRCm39) I751M probably benign Het
Hydin T A 8: 111,239,766 (GRCm39) Y2015* probably null Het
Ift43 A C 12: 86,208,275 (GRCm39) M138L probably benign Het
Il11 C T 7: 4,779,029 (GRCm39) V93M probably damaging Het
Iws1 T A 18: 32,226,645 (GRCm39) F741L possibly damaging Het
Jmy A T 13: 93,589,397 (GRCm39) I620N probably damaging Het
Kap T A 6: 133,830,689 (GRCm39) probably benign Het
Kcnk15 A G 2: 163,700,217 (GRCm39) N152S probably damaging Het
Kif16b C T 2: 142,691,783 (GRCm39) probably null Het
Kif16b T C 2: 142,743,278 (GRCm39) K5R probably benign Het
Kirrel1 C T 3: 86,992,400 (GRCm39) R555H probably damaging Het
Krt36 A G 11: 99,994,372 (GRCm39) V235A possibly damaging Het
Lca5 A G 9: 83,283,796 (GRCm39) S246P probably damaging Het
Maml1 T C 11: 50,157,575 (GRCm39) D200G probably damaging Het
Maml3 T C 3: 51,597,868 (GRCm39) R939G probably damaging Het
Mgam A T 6: 40,706,570 (GRCm39) T74S probably damaging Het
Mib2 G T 4: 155,745,351 (GRCm39) D125E probably benign Het
Muc16 A T 9: 18,462,981 (GRCm39) L7407* probably null Het
Mycbp2 A T 14: 103,446,232 (GRCm39) N1865K probably damaging Het
Naip1 A G 13: 100,563,434 (GRCm39) L577S probably damaging Het
Nell1 A T 7: 50,498,399 (GRCm39) D652V probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 (GRCm39) probably benign Het
Oas1h T A 5: 121,005,152 (GRCm39) I200N probably damaging Het
Or2h2b-ps1 A G 17: 37,480,867 (GRCm39) L122P probably damaging Het
Or2h2b-ps1 A T 17: 37,480,990 (GRCm39) I81N probably damaging Het
Or8g53 A T 9: 39,683,688 (GRCm39) M136K probably benign Het
Otog A T 7: 45,936,878 (GRCm39) Q1529L probably benign Het
Otop1 A T 5: 38,457,071 (GRCm39) I277F probably damaging Het
Pax5 G A 4: 44,645,661 (GRCm39) Q223* probably null Het
Pcdha9 T A 18: 37,132,998 (GRCm39) I689N probably benign Het
Pcsk6 A T 7: 65,576,975 (GRCm39) R138* probably null Het
Pitpnm3 A T 11: 72,003,132 (GRCm39) N59K probably damaging Het
Pla2g4d G A 2: 120,100,442 (GRCm39) T630I probably damaging Het
Plekhg5 T A 4: 152,188,372 (GRCm39) probably benign Het
Plxnb1 T A 9: 108,937,178 (GRCm39) probably benign Het
Prss28 T A 17: 25,528,395 (GRCm39) L6H probably damaging Het
Pyroxd1 T A 6: 142,302,251 (GRCm39) V228E Het
Ripk2 G A 4: 16,123,699 (GRCm39) T492M possibly damaging Het
Satb1 A T 17: 52,112,381 (GRCm39) C78S probably damaging Het
Scaf11 A T 15: 96,316,557 (GRCm39) C1002* probably null Het
Scarf2 A C 16: 17,622,768 (GRCm39) Q499P probably damaging Het
Selenbp1 T A 3: 94,847,425 (GRCm39) M244K probably benign Het
Sik2 T C 9: 50,806,647 (GRCm39) N921S probably benign Het
Slc25a1 A T 16: 17,743,744 (GRCm39) V290E probably damaging Het
Slc28a3 C T 13: 58,719,254 (GRCm39) probably benign Het
Slc35b4 A T 6: 34,137,442 (GRCm39) D213E probably benign Het
Slc40a1 A C 1: 45,950,495 (GRCm39) M319R probably damaging Het
Slc8a1 A T 17: 81,955,282 (GRCm39) F585L possibly damaging Het
Slco3a1 T A 7: 73,970,324 (GRCm39) N428Y possibly damaging Het
Slfn2 G A 11: 82,960,363 (GRCm39) C114Y probably damaging Het
Smg5 T C 3: 88,267,714 (GRCm39) probably null Het
Spata13 T A 14: 60,993,896 (GRCm39) L1116Q possibly damaging Het
Spmap1 C T 11: 97,666,510 (GRCm39) V59M probably damaging Het
Syne1 A G 10: 5,177,579 (GRCm39) V4965A possibly damaging Het
Tacc3 G T 5: 33,826,169 (GRCm39) V472F possibly damaging Het
Tacr3 T A 3: 134,560,573 (GRCm39) Y171N probably damaging Het
Tacr3 T G 3: 134,560,718 (GRCm39) L219R probably damaging Het
Tbx3 C A 5: 119,818,886 (GRCm39) A507E possibly damaging Het
Telo2 A T 17: 25,324,402 (GRCm39) D494E probably damaging Het
Tfip11 T C 5: 112,484,921 (GRCm39) F744S possibly damaging Het
Tgm3 A C 2: 129,880,403 (GRCm39) N403T probably benign Het
Thoc3 A T 13: 54,615,708 (GRCm39) S119T possibly damaging Het
Tmem176b A T 6: 48,812,530 (GRCm39) I145N probably damaging Het
Trio T A 15: 27,732,773 (GRCm39) Q3036L probably benign Het
Trpc4 T C 3: 54,102,132 (GRCm39) V10A probably benign Het
Trpm3 A G 19: 22,896,124 (GRCm39) Y987C probably damaging Het
Tspoap1 A G 11: 87,654,394 (GRCm39) K225E probably damaging Het
Txnrd3 A T 6: 89,638,477 (GRCm39) Q222L possibly damaging Het
Usp34 A T 11: 23,414,267 (GRCm39) M2756L Het
Vmn2r81 C T 10: 79,129,704 (GRCm39) T865I probably damaging Het
Vnn1 A G 10: 23,776,714 (GRCm39) Y355C probably damaging Het
Wipf2 A T 11: 98,783,092 (GRCm39) S173C probably damaging Het
Wnt1 A T 15: 98,689,624 (GRCm39) H137L probably damaging Het
Xylt2 A T 11: 94,561,278 (GRCm39) C162S probably damaging Het
Zfp426 T C 9: 20,387,744 (GRCm39) E33G probably damaging Het
Zfp811 A C 17: 33,017,801 (GRCm39) C80G possibly damaging Het
Zfp931 T C 2: 177,709,591 (GRCm39) H265R probably damaging Het
Zfp931 G A 2: 177,709,592 (GRCm39) H265Y probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCGAGTGTGGTATTTCAAGATG -3'
(R):5'- CTAAATGTGGTCTGCAGCTGG -3'

Sequencing Primer
(F):5'- GGTATTTCAAGATGACTCTTTGGAG -3'
(R):5'- TGCGTCTGAGCAAAAGTCAC -3'
Posted On 2021-10-11